Incidental Mutation 'R5010:Snx31'
ID 390457
Institutional Source Beutler Lab
Gene Symbol Snx31
Ensembl Gene ENSMUSG00000013611
Gene Name sorting nexin 31
Synonyms 4631426E05Rik
MMRRC Submission 042601-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5010 (G1)
Quality Score 186
Status Validated
Chromosome 15
Chromosomal Location 36504208-36555718 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36555469 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 26 (V26E)
Ref Sequence ENSEMBL: ENSMUSP00000124063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013755] [ENSMUST00000161202]
AlphaFold Q6P8Y7
Predicted Effect probably damaging
Transcript: ENSMUST00000013755
AA Change: V26E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013755
Gene: ENSMUSG00000013611
AA Change: V26E

DomainStartEndE-ValueType
PX 1 105 5.44e-9 SMART
PDB:4GXB|A 112 382 1e-64 PDB
Blast:B41 115 324 1e-49 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000161202
AA Change: V26E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124063
Gene: ENSMUSG00000013611
AA Change: V26E

DomainStartEndE-ValueType
PX 1 105 5.44e-9 SMART
PDB:4GXB|A 112 382 1e-64 PDB
Blast:B41 115 324 1e-49 BLAST
Meta Mutation Damage Score 0.6346 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,313,630 (GRCm39) A86V possibly damaging Het
9430097D07Rik A G 2: 32,464,440 (GRCm39) probably benign Het
Actr5 T A 2: 158,477,283 (GRCm39) D411E probably benign Het
Ang5 A G 14: 44,200,302 (GRCm39) D122G probably benign Het
Atg9a A T 1: 75,162,704 (GRCm39) probably null Het
Cracd G C 5: 76,805,681 (GRCm39) probably benign Het
Dctd C T 8: 48,590,449 (GRCm39) probably benign Het
Ddx11 G A 17: 66,454,717 (GRCm39) V642M possibly damaging Het
Dis3l2 G A 1: 86,688,043 (GRCm39) V100I probably benign Het
Echdc2 T C 4: 108,029,328 (GRCm39) V111A probably benign Het
Egr1 A G 18: 34,996,711 (GRCm39) T498A probably benign Het
Exosc3 T C 4: 45,317,702 (GRCm39) K200R possibly damaging Het
Exosc8 T C 3: 54,636,644 (GRCm39) D229G probably benign Het
Ext1 T A 15: 52,955,808 (GRCm39) I430F probably damaging Het
Fbxw22 T C 9: 109,232,492 (GRCm39) N31S probably benign Het
Gja8 T C 3: 96,827,165 (GRCm39) T166A probably benign Het
Gm21814 T A 6: 149,485,116 (GRCm39) noncoding transcript Het
Gm21915 T A 9: 40,581,944 (GRCm39) H12Q probably benign Het
Hgsnat G A 8: 26,437,988 (GRCm39) R527* probably null Het
Iqgap2 A G 13: 95,810,251 (GRCm39) F731S probably benign Het
Jchain T C 5: 88,670,364 (GRCm39) H85R probably damaging Het
Kcnb2 T C 1: 15,383,186 (GRCm39) C171R probably benign Het
Kcnk3 C A 5: 30,780,149 (GRCm39) R400S possibly damaging Het
Klhl28 C T 12: 65,004,001 (GRCm39) E171K probably damaging Het
Lrrfip2 T C 9: 111,053,040 (GRCm39) I375T possibly damaging Het
Mccc1 T C 3: 36,033,166 (GRCm39) N326S probably benign Het
Med13l T C 5: 118,731,615 (GRCm39) V97A possibly damaging Het
Mertk C A 2: 128,625,920 (GRCm39) T685K probably benign Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Myom2 G A 8: 15,133,310 (GRCm39) V401M probably damaging Het
Nme5 A C 18: 34,711,738 (GRCm39) M1R probably null Het
Nop2 T C 6: 125,110,726 (GRCm39) S68P probably benign Het
Notch1 A T 2: 26,366,126 (GRCm39) D809E possibly damaging Het
Or14c39 T C 7: 86,343,793 (GRCm39) I43T possibly damaging Het
Ppat C T 5: 77,076,525 (GRCm39) probably benign Het
Prss23 T A 7: 89,159,422 (GRCm39) M216L probably benign Het
Psg18 A T 7: 18,083,279 (GRCm39) V171D probably damaging Het
Psg28 A G 7: 18,161,816 (GRCm39) V229A probably damaging Het
Qser1 T C 2: 104,618,176 (GRCm39) N879D possibly damaging Het
Rpap1 T C 2: 119,600,522 (GRCm39) N879S probably benign Het
Rusc2 T C 4: 43,415,926 (GRCm39) S411P probably damaging Het
Rxfp2 T A 5: 149,990,825 (GRCm39) W519R probably damaging Het
Scpep1 T A 11: 88,832,175 (GRCm39) Q185L probably benign Het
Serpinb11 A G 1: 107,307,379 (GRCm39) N270S probably benign Het
Serpinb6d T A 13: 33,855,427 (GRCm39) M367K probably benign Het
Skint10 T G 4: 112,584,869 (GRCm39) I213L probably benign Het
Skint5 T C 4: 113,403,734 (GRCm39) T1163A unknown Het
Slamf9 A T 1: 172,303,780 (GRCm39) I42L possibly damaging Het
Slc1a3 T C 15: 8,680,330 (GRCm39) probably benign Het
Smad6 T A 9: 63,861,182 (GRCm39) Q371L possibly damaging Het
Spata31e5 A G 1: 28,816,943 (GRCm39) I363T possibly damaging Het
Taf4b A G 18: 14,955,229 (GRCm39) N594S possibly damaging Het
Tanc2 T C 11: 105,670,918 (GRCm39) S172P probably damaging Het
Tas2r110 T A 6: 132,845,438 (GRCm39) Y156* probably null Het
Tbc1d20 G A 2: 152,135,856 (GRCm39) probably benign Het
Timm50 A T 7: 28,006,284 (GRCm39) D272E probably benign Het
Ttn T G 2: 76,730,855 (GRCm39) probably benign Het
Vps13c T A 9: 67,823,661 (GRCm39) F1362I probably benign Het
Vwf T C 6: 125,543,220 (GRCm39) S154P probably benign Het
Zfp445 T C 9: 122,681,410 (GRCm39) R844G probably benign Het
Other mutations in Snx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Snx31 APN 15 36,545,761 (GRCm39) critical splice acceptor site probably null
IGL01627:Snx31 APN 15 36,517,818 (GRCm39) missense probably damaging 1.00
IGL02514:Snx31 APN 15 36,525,728 (GRCm39) missense probably damaging 1.00
IGL03069:Snx31 APN 15 36,525,749 (GRCm39) nonsense probably null
IGL03182:Snx31 APN 15 36,525,833 (GRCm39) missense probably benign 0.00
R0755:Snx31 UTSW 15 36,534,576 (GRCm39) missense probably damaging 0.99
R1005:Snx31 UTSW 15 36,517,837 (GRCm39) splice site probably benign
R1463:Snx31 UTSW 15 36,539,444 (GRCm39) missense probably null 1.00
R1513:Snx31 UTSW 15 36,545,745 (GRCm39) missense probably damaging 0.99
R2030:Snx31 UTSW 15 36,525,848 (GRCm39) missense probably benign 0.31
R3404:Snx31 UTSW 15 36,525,799 (GRCm39) missense probably benign 0.00
R3720:Snx31 UTSW 15 36,523,704 (GRCm39) critical splice acceptor site probably null
R4152:Snx31 UTSW 15 36,525,785 (GRCm39) missense probably benign
R4474:Snx31 UTSW 15 36,546,256 (GRCm39) intron probably benign
R4729:Snx31 UTSW 15 36,523,698 (GRCm39) missense possibly damaging 0.92
R4998:Snx31 UTSW 15 36,539,513 (GRCm39) missense probably damaging 0.96
R5375:Snx31 UTSW 15 36,525,730 (GRCm39) missense probably damaging 0.99
R5893:Snx31 UTSW 15 36,523,601 (GRCm39) missense probably damaging 0.98
R5970:Snx31 UTSW 15 36,523,634 (GRCm39) nonsense probably null
R6211:Snx31 UTSW 15 36,547,030 (GRCm39) missense probably damaging 0.98
R7198:Snx31 UTSW 15 36,555,455 (GRCm39) missense probably benign 0.04
R7293:Snx31 UTSW 15 36,523,596 (GRCm39) missense probably damaging 0.97
R7329:Snx31 UTSW 15 36,555,621 (GRCm39) missense probably benign 0.00
R7741:Snx31 UTSW 15 36,523,587 (GRCm39) critical splice donor site probably null
R8057:Snx31 UTSW 15 36,523,606 (GRCm39) missense probably damaging 0.98
R8791:Snx31 UTSW 15 36,537,678 (GRCm39) missense probably benign 0.01
R8806:Snx31 UTSW 15 36,537,698 (GRCm39) missense probably damaging 1.00
R9349:Snx31 UTSW 15 36,555,430 (GRCm39) missense probably damaging 1.00
R9655:Snx31 UTSW 15 36,534,582 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATTTAAAGAGTGCCTATAGTTCAC -3'
(R):5'- ATCGCCAGAGCCATGAAGATG -3'

Sequencing Primer
(F):5'- GTGCCTATAGTTCACAAATCAGGAGC -3'
(R):5'- GCACTTCTGCATCCCGGTG -3'
Posted On 2016-06-06