Incidental Mutation 'R5010:Nme5'
ID390462
Institutional Source Beutler Lab
Gene Symbol Nme5
Ensembl Gene ENSMUSG00000035984
Gene NameNME/NM23 family member 5
Synonymsnon-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase), Nm23-M5, 1700019D05Rik
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location34562634-34579115 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to C at 34578685 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 1 (M1R)
Ref Sequence ENSEMBL: ENSMUSP00000117443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056932] [ENSMUST00000079287] [ENSMUST00000129566] [ENSMUST00000134875] [ENSMUST00000154342] [ENSMUST00000155114]
Predicted Effect probably benign
Transcript: ENSMUST00000056932
SMART Domains Protein: ENSMUSP00000054234
Gene: ENSMUSG00000049357

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 47 65 N/A INTRINSIC
low complexity region 77 86 N/A INTRINSIC
BROMO 153 261 8.66e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000079287
AA Change: M1R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078269
Gene: ENSMUSG00000035984
AA Change: M1R

DomainStartEndE-ValueType
NDK 12 150 1.9e-62 SMART
Pfam:Dpy-30 156 197 7.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129566
SMART Domains Protein: ENSMUSP00000117272
Gene: ENSMUSG00000049357

DomainStartEndE-ValueType
Blast:BROMO 20 197 5e-25 BLAST
SCOP:d1f68a_ 161 204 1e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000134875
AA Change: M1R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118213
Gene: ENSMUSG00000035984
AA Change: M1R

DomainStartEndE-ValueType
NDK 12 113 2.91e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154342
AA Change: M1R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117443
Gene: ENSMUSG00000035984
AA Change: M1R

DomainStartEndE-ValueType
NDK 12 113 2.91e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000155114
AA Change: M1R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit hydrocephaly and male spermatogenesis defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Nme5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Nme5 APN 18 34567128 missense probably benign 0.20
IGL01016:Nme5 APN 18 34578659 splice site probably null
IGL01982:Nme5 APN 18 34569875 missense probably damaging 0.96
IGL02336:Nme5 APN 18 34578677 missense probably benign 0.35
IGL02897:Nme5 APN 18 34569903 intron probably benign
aesthenic UTSW 18 34578685 start codon destroyed probably null 1.00
R1209:Nme5 UTSW 18 34569896 missense probably damaging 1.00
R1221:Nme5 UTSW 18 34571522 missense probably damaging 1.00
R3855:Nme5 UTSW 18 34569831 missense possibly damaging 0.48
R4729:Nme5 UTSW 18 34569837 missense probably benign
R6658:Nme5 UTSW 18 34578586 missense probably damaging 1.00
R6820:Nme5 UTSW 18 34571573 missense probably damaging 1.00
R7593:Nme5 UTSW 18 34567148 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCGGGTGGCTACATTTATATAGG -3'
(R):5'- GTCCTCCAACCTCAGTCAAG -3'

Sequencing Primer
(F):5'- TGGTGAATCCAGATCCCA -3'
(R):5'- CGTGCAGTACAAGTCGGATTC -3'
Posted On2016-06-06