Incidental Mutation 'R5010:Egr1'
ID390463
Institutional Source Beutler Lab
Gene Symbol Egr1
Ensembl Gene ENSMUSG00000038418
Gene Nameearly growth response 1
SynonymsZfp-6, Krox-1, Zenk, Zif268, NGF1-A, A530045N19Rik, NGFI-A, NGFIA, ETR103, TIS8, Krox-24, Krox24, Egr-1
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.838) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location34859823-34864984 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34863658 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 498 (T498A)
Ref Sequence ENSEMBL: ENSMUSP00000126931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064795] [ENSMUST00000165033]
Predicted Effect probably benign
Transcript: ENSMUST00000064795
AA Change: T498A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069616
Gene: ENSMUSG00000038418
AA Change: T498A

DomainStartEndE-ValueType
low complexity region 57 81 N/A INTRINSIC
Pfam:DUF3446 132 217 8.9e-28 PFAM
ZnF_C2H2 336 360 3.21e-4 SMART
ZnF_C2H2 366 388 2.91e-2 SMART
ZnF_C2H2 394 416 1.36e-2 SMART
Pfam:DUF3432 426 520 4.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165033
AA Change: T498A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126931
Gene: ENSMUSG00000038418
AA Change: T498A

DomainStartEndE-ValueType
low complexity region 57 81 N/A INTRINSIC
Pfam:DUF3446 132 217 1.4e-30 PFAM
ZnF_C2H2 336 360 3.21e-4 SMART
ZnF_C2H2 366 388 2.91e-2 SMART
ZnF_C2H2 394 416 1.36e-2 SMART
Pfam:DUF3432 424 520 2.5e-32 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the EGR family of C2H2-type zinc-finger proteins. It is a nuclear protein and functions as a transcriptional regulator. The products of target genes it activates are required for differentitation and mitogenesis. Studies suggest this is a cancer suppressor gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for targeted mutations are small and infertile due to pituitary defects. Mutants exhibit reductions in somatotropes and growth hormone content, and a lack of luteinizing hormone-beta expression. Ovaries lack luteinizing hormone receptors. Memory defects are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Egr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Egr1 APN 18 34862494 missense possibly damaging 0.91
IGL02175:Egr1 APN 18 34863055 missense probably benign 0.26
IGL02247:Egr1 APN 18 34862863 missense possibly damaging 0.94
PIT4651001:Egr1 UTSW 18 34863187 nonsense probably null
R0362:Egr1 UTSW 18 34863313 missense possibly damaging 0.95
R1998:Egr1 UTSW 18 34861534 missense probably benign 0.00
R7762:Egr1 UTSW 18 34863545 missense probably damaging 0.99
R8318:Egr1 UTSW 18 34863610 missense probably damaging 0.97
Z1177:Egr1 UTSW 18 34863230 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAAAAGTGTGGTGGCCTCC -3'
(R):5'- GGCTCTGAGATCTTCCATCTG -3'

Sequencing Primer
(F):5'- CTCTTCTTACCCATCCCCAGTGG -3'
(R):5'- GAGATCTTCCATCTGACCTAAGAGG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

R50100068_PCR_F: 5’- ACAAAAGTGTGGTGGCCTCC-3’

R50100068_PCR_R: 5’- GGCTCTGAGATCTTCCATCTG-3’

 

Sequencing Primers

R50100068_SEQ_F: 5’- CTCTTCTTACCCATCCCCAGTGG-3’
 

R50100068_SEQ_R: 5’- GAGATCTTCCATCTGACCTAAGAGG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 439 nucleotides is amplified:

 

2221 gacaagaaag cagacaaaag tgtggtggcc tccccggctg cctcttcact ctcttcttac      
2281 ccatccccag tggctacctc ctacccatcc cctgccacca cctcattccc atcccctgtg      
2341 cccacttcct actcctctcc tggctcctcc acctacccat ctcctgcgca cagtggcttc      
2401 ccgtcgccgt cagtggccac cacctttgcc tccgttccac ctgctttccc cacccaggtc      
2461 agcagcttcc cgtctgcggg cgtcagcagc tccttcagca cctcaactgg tctttcagac      
2521 atgacagcga ccttttctcc caggacaatt gaaatttgct aaagggaata aaagaaagca      
2581 aagggagagg caggaaagac ataaaagcac aggagggaag agatggccgc aagaggggcc      
2641 acctcttagg tcagatggaa gatctcagag cc

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>G).

Posted On2016-06-06