Incidental Mutation 'R5011:Atg16l1'
ID390467
Institutional Source Beutler Lab
Gene Symbol Atg16l1
Ensembl Gene ENSMUSG00000026289
Gene Nameautophagy related 16-like 1 (S. cerevisiae)
Synonyms1500009K01Rik, APG16L, WDR30
MMRRC Submission 042602-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5011 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87755870-87792428 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 87774180 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 248 (S248*)
Ref Sequence ENSEMBL: ENSMUSP00000108815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027512] [ENSMUST00000113186] [ENSMUST00000113190] [ENSMUST00000144047]
Predicted Effect probably null
Transcript: ENSMUST00000027512
AA Change: S248*
SMART Domains Protein: ENSMUSP00000027512
Gene: ENSMUSG00000026289
AA Change: S248*

DomainStartEndE-ValueType
Pfam:ATG16 13 207 1.3e-63 PFAM
low complexity region 237 246 N/A INTRINSIC
WD40 311 350 7.05e-9 SMART
WD40 355 394 7.28e-2 SMART
WD40 397 436 1.07e-8 SMART
WD40 439 475 3.7e0 SMART
WD40 478 516 5.35e-1 SMART
WD40 519 562 1.2e-2 SMART
WD40 565 605 6.89e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113186
AA Change: S248*
SMART Domains Protein: ENSMUSP00000108811
Gene: ENSMUSG00000026289
AA Change: S248*

DomainStartEndE-ValueType
Pfam:ATG16 13 207 3.7e-64 PFAM
low complexity region 237 246 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
WD40 292 331 7.05e-9 SMART
WD40 336 375 7.28e-2 SMART
WD40 378 417 1.07e-8 SMART
WD40 420 456 3.7e0 SMART
WD40 459 497 5.35e-1 SMART
WD40 500 543 1.2e-2 SMART
WD40 546 586 6.89e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113190
AA Change: S248*
SMART Domains Protein: ENSMUSP00000108815
Gene: ENSMUSG00000026289
AA Change: S248*

DomainStartEndE-ValueType
Pfam:ATG16 16 206 6.5e-49 PFAM
low complexity region 237 246 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
WD40 327 366 7.05e-9 SMART
WD40 371 410 7.28e-2 SMART
WD40 413 452 1.07e-8 SMART
WD40 455 491 3.7e0 SMART
WD40 494 532 5.35e-1 SMART
WD40 535 578 1.2e-2 SMART
WD40 581 621 6.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139628
Predicted Effect probably benign
Transcript: ENSMUST00000144047
SMART Domains Protein: ENSMUSP00000120955
Gene: ENSMUSG00000026289

DomainStartEndE-ValueType
Pfam:ATG16 1 145 2.9e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157343
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Null homozygotes have a cellular defect in autophagy that results in lethality during the neonatal starvation period. Mice homozygous for hypomorphic alleles have Paneth cells with aberrant, disorganized granules similar to those found in patients with Crohn's disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T C 11: 107,028,498 V223A probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Atxn1 T C 13: 45,557,069 N796D probably damaging Het
C3 T A 17: 57,223,236 Y455F probably benign Het
Card11 A T 5: 140,876,520 D1007E possibly damaging Het
Cbr2 T C 11: 120,730,871 D60G possibly damaging Het
Cgn T A 3: 94,776,145 E400V probably null Het
Chil3 T A 3: 106,150,161 Y229F possibly damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Clk1 T C 1: 58,414,483 I315V probably benign Het
Cops6 A G 5: 138,162,197 D102G probably benign Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnaaf5 T A 5: 139,163,257 L437Q probably damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Draxin C A 4: 148,107,979 R292L probably damaging Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fat1 A T 8: 45,031,263 probably null Het
Fbxl18 A G 5: 142,886,680 S267P probably damaging Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Fgd2 T C 17: 29,374,980 probably null Het
Gm7251 T A 13: 49,805,180 noncoding transcript Het
Golt1a T C 1: 133,320,268 V78A probably damaging Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Gtf2ird2 G T 5: 134,216,982 S694I possibly damaging Het
H2-Ob T A 17: 34,241,279 probably null Het
Hsp90b1 T C 10: 86,696,753 D353G probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itga7 G A 10: 128,949,447 V836M possibly damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Ivns1abp T A 1: 151,363,202 M589K possibly damaging Het
Jakmip3 C T 7: 139,020,222 R284W probably damaging Het
Kank3 T C 17: 33,822,070 L512P probably damaging Het
Kcnn2 T A 18: 45,685,285 I483N possibly damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lbr A T 1: 181,819,888 Y199* probably null Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Ltbp1 T A 17: 75,066,157 L265H probably damaging Het
Maml3 A T 3: 51,690,775 N183K possibly damaging Het
Mprip T C 11: 59,759,895 V1475A possibly damaging Het
Myh4 C A 11: 67,256,363 S1611R probably benign Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nudt12 T C 17: 58,996,504 probably benign Het
Nup153 T C 13: 46,687,403 T910A possibly damaging Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Olfr391-ps T A 11: 73,799,647 T37S possibly damaging Het
Pbx2 T A 17: 34,594,699 C224* probably null Het
Pcdha6 A G 18: 36,967,907 D51G probably damaging Het
Pnpla1 C T 17: 28,885,584 T538I possibly damaging Het
Pnpla2 T C 7: 141,459,291 probably null Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ranbp2 T A 10: 58,461,895 S375T probably benign Het
Rimbp2 T C 5: 128,803,921 Y134C probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Sh3tc1 G T 5: 35,700,289 A1185D probably damaging Het
Sin3b G A 8: 72,744,556 S377N probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spink5 A T 18: 44,006,412 N614I probably damaging Het
Tert T C 13: 73,646,309 probably null Het
Thap4 T C 1: 93,749,876 Y396C probably damaging Het
Tle2 T C 10: 81,584,697 L348P probably damaging Het
Tmem104 T C 11: 115,243,486 S283P probably damaging Het
Tnn T C 1: 160,126,379 E602G possibly damaging Het
Tpm4 A G 8: 72,147,094 K190R probably benign Het
Ttf2 T C 3: 100,963,169 E196G probably benign Het
Ugt3a2 T C 15: 9,365,287 W329R probably damaging Het
Unc13a G A 8: 71,641,477 Q1327* probably null Het
Vmn1r194 C T 13: 22,244,888 T225I probably benign Het
Vmn1r215 T C 13: 23,076,551 S254P probably damaging Het
Vmn2r109 T C 17: 20,555,189 E92G probably damaging Het
Ythdc2 A G 18: 44,854,742 M625V probably benign Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zfp768 T C 7: 127,343,703 R418G probably damaging Het
Zmynd11 C T 13: 9,689,443 probably benign Het
Other mutations in Atg16l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Atg16l1 APN 1 87765397 missense possibly damaging 0.68
IGL00861:Atg16l1 APN 1 87774838 missense probably damaging 1.00
IGL01065:Atg16l1 APN 1 87785931 missense probably damaging 0.99
IGL01068:Atg16l1 APN 1 87774824 missense probably damaging 1.00
IGL01140:Atg16l1 APN 1 87774853 missense probably benign 0.03
R0023:Atg16l1 UTSW 1 87789465 missense probably benign 0.00
R0023:Atg16l1 UTSW 1 87789465 missense probably benign 0.00
R0650:Atg16l1 UTSW 1 87781699 missense possibly damaging 0.93
R0655:Atg16l1 UTSW 1 87766829 missense probably damaging 1.00
R1421:Atg16l1 UTSW 1 87786358 splice site probably benign
R1549:Atg16l1 UTSW 1 87774188 missense probably benign
R2202:Atg16l1 UTSW 1 87767015 missense probably benign 0.03
R2204:Atg16l1 UTSW 1 87767015 missense probably benign 0.03
R3689:Atg16l1 UTSW 1 87785904 missense probably damaging 1.00
R4012:Atg16l1 UTSW 1 87766907 missense probably damaging 1.00
R4391:Atg16l1 UTSW 1 87760120 missense probably damaging 0.97
R4839:Atg16l1 UTSW 1 87766174 missense probably damaging 0.99
R4935:Atg16l1 UTSW 1 87767042 missense possibly damaging 0.69
R4980:Atg16l1 UTSW 1 87766831 missense possibly damaging 0.89
R4990:Atg16l1 UTSW 1 87789369 missense probably benign 0.00
R5457:Atg16l1 UTSW 1 87775091 missense probably damaging 0.96
R5897:Atg16l1 UTSW 1 87785997 critical splice donor site probably null
R6289:Atg16l1 UTSW 1 87756215 missense probably damaging 0.99
R6437:Atg16l1 UTSW 1 87790648 missense probably damaging 1.00
R6727:Atg16l1 UTSW 1 87774854 missense possibly damaging 0.68
R6923:Atg16l1 UTSW 1 87774356 intron probably null
R7423:Atg16l1 UTSW 1 87786301 missense probably damaging 1.00
R7475:Atg16l1 UTSW 1 87760083 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCGTTAGTTTCTCACATCGTGG -3'
(R):5'- ATGTTAGGCCACTGGTACCC -3'

Sequencing Primer
(F):5'- AGTTTCTCACATCGTGGAGTTC -3'
(R):5'- TAGGCCACTGGTACCCTGTCTC -3'
Posted On2016-06-06