Incidental Mutation 'R0437:Chrm4'
ID39048
Institutional Source Beutler Lab
Gene Symbol Chrm4
Ensembl Gene ENSMUSG00000040495
Gene Namecholinergic receptor, muscarinic 4
SynonymsChrm-4, muscarinic acetylcholine receptor 4
MMRRC Submission 038638-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0437 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91927249-91928688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91928443 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 399 (T399A)
Ref Sequence ENSEMBL: ENSMUSP00000040808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028667] [ENSMUST00000028672] [ENSMUST00000045537] [ENSMUST00000069423] [ENSMUST00000090602] [ENSMUST00000099709] [ENSMUST00000111303] [ENSMUST00000111309] [ENSMUST00000128152] [ENSMUST00000142231]
Predicted Effect probably benign
Transcript: ENSMUST00000028667
SMART Domains Protein: ENSMUSP00000028667
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
C1 96 153 2.67e-1 SMART
C1 173 231 8.18e-7 SMART
low complexity region 257 274 N/A INTRINSIC
DAGKc 296 420 4.61e-65 SMART
DAGKa 447 604 2.75e-95 SMART
low complexity region 762 780 N/A INTRINSIC
ANK 823 853 8.52e-4 SMART
ANK 858 887 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028672
SMART Domains Protein: ENSMUSP00000028672
Gene: ENSMUSG00000027239

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000045537
AA Change: T399A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040808
Gene: ENSMUSG00000040495
AA Change: T399A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 42 248 5.7e-7 PFAM
Pfam:7tm_1 48 453 5.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069423
SMART Domains Protein: ENSMUSP00000068413
Gene: ENSMUSG00000027239

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090602
SMART Domains Protein: ENSMUSP00000088090
Gene: ENSMUSG00000027239

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099709
SMART Domains Protein: ENSMUSP00000106937
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
C1 113 170 2.67e-1 SMART
C1 190 248 8.18e-7 SMART
low complexity region 274 291 N/A INTRINSIC
DAGKc 313 437 4.61e-65 SMART
DAGKa 464 621 2.75e-95 SMART
low complexity region 779 797 N/A INTRINSIC
ANK 840 870 8.52e-4 SMART
ANK 875 904 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111303
SMART Domains Protein: ENSMUSP00000106934
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
low complexity region 118 133 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
C1 290 347 2.67e-1 SMART
C1 367 425 8.18e-7 SMART
low complexity region 451 468 N/A INTRINSIC
DAGKc 490 614 4.61e-65 SMART
DAGKa 641 798 2.75e-95 SMART
low complexity region 956 974 N/A INTRINSIC
ANK 1017 1047 8.52e-4 SMART
ANK 1052 1081 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111309
SMART Domains Protein: ENSMUSP00000106941
Gene: ENSMUSG00000027239

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128152
SMART Domains Protein: ENSMUSP00000118684
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:C1 62 114 9e-33 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138894
Predicted Effect probably benign
Transcript: ENSMUST00000142231
SMART Domains Protein: ENSMUSP00000114740
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Meta Mutation Damage Score 0.1120 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The clinical implications of this receptor are unknown; however, mouse studies link its function to adenylyl cyclase inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show decreased body weight, hyperactivity, abnormalities in carbamylcholine-induced bradycardia and gallbladder contractility, and altered CNS synaptic transmission. Mice homozygous for a different null allele show loss of the anti-cataleptic effect of scopolamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,953 L21P probably damaging Het
4833420G17Rik G A 13: 119,470,095 R291K probably benign Het
4932438A13Rik A T 3: 36,989,804 H2820L possibly damaging Het
Abca2 T C 2: 25,442,845 S1519P probably damaging Het
Abcb11 G A 2: 69,257,295 A1042V probably damaging Het
Abcc10 A T 17: 46,312,919 probably null Het
Abcc10 G T 17: 46,312,920 probably benign Het
Alkbh3 A C 2: 93,981,569 L240V probably damaging Het
Apol10b T C 15: 77,585,408 S190G probably benign Het
Atp1a3 C A 7: 24,998,967 C135F probably benign Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
BC030499 T C 11: 78,291,536 L57P probably benign Het
Bicra A G 7: 15,988,762 S277P possibly damaging Het
Bmp8a T C 4: 123,316,897 E275G probably benign Het
Ccdc102a T C 8: 94,913,426 E80G probably damaging Het
Cdh23 T C 10: 60,410,797 D954G probably damaging Het
Clcn3 A G 8: 60,934,537 V199A possibly damaging Het
Crlf1 T C 8: 70,499,514 probably null Het
Crx G T 7: 15,871,146 S57* probably null Het
Cyp4f16 A G 17: 32,537,098 I34V possibly damaging Het
Daxx T C 17: 33,913,624 V576A probably benign Het
Ddx17 C T 15: 79,537,471 R351H probably damaging Het
Dhx38 T C 8: 109,558,629 probably benign Het
Dnd1 T C 18: 36,764,499 probably benign Het
Dync1i2 A T 2: 71,227,825 probably null Het
E2f6 T C 12: 16,816,445 S52P probably benign Het
Epb41l4a A G 18: 33,880,273 F116S probably damaging Het
Ext1 T C 15: 53,106,106 N362S probably damaging Het
Fam227a C A 15: 79,643,988 K79N possibly damaging Het
Fam228a T A 12: 4,732,759 L111F probably damaging Het
Fat2 T C 11: 55,282,799 T2363A probably benign Het
Fat3 A T 9: 15,996,932 N2591K probably damaging Het
Frem2 A G 3: 53,653,015 M1357T possibly damaging Het
Frmd4b A T 6: 97,423,463 V29D probably damaging Het
G930045G22Rik A G 6: 50,846,938 noncoding transcript Het
Galnt3 A G 2: 66,107,229 S46P possibly damaging Het
Gmeb2 A G 2: 181,253,973 V468A possibly damaging Het
Herc2 C T 7: 56,219,815 R4271* probably null Het
Il5 C A 11: 53,723,906 probably benign Het
Ints9 G A 14: 64,986,369 probably benign Het
Itga10 T C 3: 96,649,137 F196S probably damaging Het
Itgb3bp T C 4: 99,781,889 T138A probably damaging Het
Kcnd1 G A X: 7,824,683 V281M probably benign Het
Lcp2 T C 11: 34,087,229 L391P probably benign Het
Lrrc66 T C 5: 73,607,687 Y671C probably benign Het
Mettl23 T C 11: 116,849,294 V197A possibly damaging Het
Mmp15 C A 8: 95,370,772 D456E probably benign Het
Mospd4 T C 18: 46,465,781 noncoding transcript Het
Mov10l1 C A 15: 89,005,312 H484N probably damaging Het
Mphosph9 T C 5: 124,315,568 Q197R probably benign Het
Ms4a1 T A 19: 11,256,569 probably null Het
Mybbp1a T C 11: 72,448,848 V919A possibly damaging Het
Mycbpap A T 11: 94,513,512 probably benign Het
Naip6 G A 13: 100,296,924 S1135F possibly damaging Het
Ndufc2 T A 7: 97,400,337 M50K probably benign Het
Npr2 T C 4: 43,648,082 V842A probably damaging Het
Ntsr2 G T 12: 16,653,695 G66W probably damaging Het
Obscn T C 11: 58,995,088 probably benign Het
Olfr1206 T A 2: 88,864,885 N93K probably benign Het
Olfr1219 T A 2: 89,074,612 I160F probably benign Het
Olfr427 G A 1: 174,100,399 G314R probably benign Het
Olfr820 T C 10: 130,018,096 V245A probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Otud4 T A 8: 79,669,997 H628Q probably benign Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pex16 G T 2: 92,375,592 R10L probably damaging Het
Pitpnm2 A G 5: 124,131,089 probably benign Het
Pom121l2 A G 13: 21,983,205 T549A possibly damaging Het
Prdm15 A T 16: 97,812,559 M470K probably benign Het
Prkag2 T A 5: 25,028,505 D49V possibly damaging Het
Prl3c1 A G 13: 27,199,464 M38V probably benign Het
Prpf18 T A 2: 4,643,761 I85F possibly damaging Het
Psg27 A G 7: 18,560,711 probably benign Het
Relt A G 7: 100,848,784 probably benign Het
Serpina3b A T 12: 104,130,670 N70I probably damaging Het
Slc19a3 T C 1: 83,022,565 S244G probably benign Het
Slc39a5 T C 10: 128,399,847 T81A possibly damaging Het
Slc7a2 G A 8: 40,904,526 G277D probably damaging Het
Slc9c1 C T 16: 45,599,887 probably benign Het
Slx1b A G 7: 126,692,581 F104L probably benign Het
Smg6 G A 11: 74,929,701 S266N probably damaging Het
Spata9 T C 13: 75,998,495 V162A possibly damaging Het
Szrd1 T C 4: 141,118,744 I47V probably benign Het
Tha1 G T 11: 117,868,575 L363M probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Tmem132d C T 5: 127,789,785 G684R probably damaging Het
Trim55 G A 3: 19,670,978 G220S probably benign Het
Ttn A G 2: 76,770,530 L18836P probably damaging Het
Ubn1 G T 16: 5,072,184 probably benign Het
Ush2a T G 1: 188,911,031 W4197G probably benign Het
Vmn1r189 A T 13: 22,102,061 V202E probably damaging Het
Vmn1r209 T C 13: 22,806,356 I55V probably benign Het
Vmn2r86 A T 10: 130,446,543 C735S probably damaging Het
Vwf A T 6: 125,566,318 D174V probably damaging Het
Zfp438 T C 18: 5,214,910 N16S probably damaging Het
Zfp444 C T 7: 6,189,409 T142I probably benign Het
Zfp804a A G 2: 82,053,791 M1V probably null Het
Zfp936 T G 7: 43,189,310 I67S probably benign Het
Zfp948 A T 17: 21,586,998 N151Y unknown Het
Other mutations in Chrm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Chrm4 APN 2 91927831 missense probably damaging 1.00
R0755:Chrm4 UTSW 2 91928402 missense probably benign 0.02
R1972:Chrm4 UTSW 2 91927493 missense probably benign 0.00
R2233:Chrm4 UTSW 2 91928530 missense probably benign 0.01
R2235:Chrm4 UTSW 2 91928530 missense probably benign 0.01
R2902:Chrm4 UTSW 2 91927957 missense probably benign 0.00
R3115:Chrm4 UTSW 2 91927360 missense probably benign 0.06
R3907:Chrm4 UTSW 2 91927739 missense probably damaging 0.98
R4839:Chrm4 UTSW 2 91927607 missense probably damaging 1.00
R7033:Chrm4 UTSW 2 91928347 missense probably benign 0.01
R7242:Chrm4 UTSW 2 91927250 start codon destroyed probably null 0.86
R7707:Chrm4 UTSW 2 91927354 missense probably benign 0.01
R8066:Chrm4 UTSW 2 91927697 missense probably damaging 1.00
R8076:Chrm4 UTSW 2 91927859 missense probably damaging 1.00
R8293:Chrm4 UTSW 2 91928218 missense probably benign 0.00
R8784:Chrm4 UTSW 2 91927688 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCAAATTGTGACAAAGCAGACAGGC -3'
(R):5'- TTCTCTTCAGCAGATGCGAACTCAG -3'

Sequencing Primer
(F):5'- CAGTGAATGTGTGACTGCCATC -3'
(R):5'- ATGTTCCGATACTGGCACAG -3'
Posted On2013-05-23