Incidental Mutation 'R5011:Ttf2'
ID390489
Institutional Source Beutler Lab
Gene Symbol Ttf2
Ensembl Gene ENSMUSG00000033222
Gene Nametranscription termination factor, RNA polymerase II
Synonyms
MMRRC Submission 042602-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5011 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location100938860-100969663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100963169 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 196 (E196G)
Ref Sequence ENSEMBL: ENSMUSP00000076208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076941]
Predicted Effect probably benign
Transcript: ENSMUST00000076941
AA Change: E196G

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076208
Gene: ENSMUSG00000033222
AA Change: E196G

DomainStartEndE-ValueType
Pfam:zf-GRF 4 44 2.3e-10 PFAM
low complexity region 328 340 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 458 479 N/A INTRINSIC
DEXDc 542 774 8.6e-35 SMART
Blast:DEXDc 839 892 8e-7 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 917 932 N/A INTRINSIC
HELICc 999 1082 5.61e-16 SMART
low complexity region 1099 1110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200506
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI2/SNF2 family of proteins, which play a critical role in altering protein-DNA interactions. The encoded protein has been shown to have dsDNA-dependent ATPase activity and RNA polymerase II termination activity. This protein interacts with cell division cycle 5-like, associates with human splicing complexes, and plays a role in pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T C 11: 107,028,498 V223A probably damaging Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Atg16l1 C A 1: 87,774,180 S248* probably null Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Atxn1 T C 13: 45,557,069 N796D probably damaging Het
C3 T A 17: 57,223,236 Y455F probably benign Het
Card11 A T 5: 140,876,520 D1007E possibly damaging Het
Cbr2 T C 11: 120,730,871 D60G possibly damaging Het
Cgn T A 3: 94,776,145 E400V probably null Het
Chil3 T A 3: 106,150,161 Y229F possibly damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Clk1 T C 1: 58,414,483 I315V probably benign Het
Cops6 A G 5: 138,162,197 D102G probably benign Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnaaf5 T A 5: 139,163,257 L437Q probably damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Draxin C A 4: 148,107,979 R292L probably damaging Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fat1 A T 8: 45,031,263 probably null Het
Fbxl18 A G 5: 142,886,680 S267P probably damaging Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Fgd2 T C 17: 29,374,980 probably null Het
Gm7251 T A 13: 49,805,180 noncoding transcript Het
Golt1a T C 1: 133,320,268 V78A probably damaging Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Gtf2ird2 G T 5: 134,216,982 S694I possibly damaging Het
H2-Ob T A 17: 34,241,279 probably null Het
Hsp90b1 T C 10: 86,696,753 D353G probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itga7 G A 10: 128,949,447 V836M possibly damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Ivns1abp T A 1: 151,363,202 M589K possibly damaging Het
Jakmip3 C T 7: 139,020,222 R284W probably damaging Het
Kank3 T C 17: 33,822,070 L512P probably damaging Het
Kcnn2 T A 18: 45,685,285 I483N possibly damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lbr A T 1: 181,819,888 Y199* probably null Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Ltbp1 T A 17: 75,066,157 L265H probably damaging Het
Maml3 A T 3: 51,690,775 N183K possibly damaging Het
Mprip T C 11: 59,759,895 V1475A possibly damaging Het
Myh4 C A 11: 67,256,363 S1611R probably benign Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nudt12 T C 17: 58,996,504 probably benign Het
Nup153 T C 13: 46,687,403 T910A possibly damaging Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Olfr391-ps T A 11: 73,799,647 T37S possibly damaging Het
Pbx2 T A 17: 34,594,699 C224* probably null Het
Pcdha6 A G 18: 36,967,907 D51G probably damaging Het
Pnpla1 C T 17: 28,885,584 T538I possibly damaging Het
Pnpla2 T C 7: 141,459,291 probably null Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ranbp2 T A 10: 58,461,895 S375T probably benign Het
Rimbp2 T C 5: 128,803,921 Y134C probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Sh3tc1 G T 5: 35,700,289 A1185D probably damaging Het
Sin3b G A 8: 72,744,556 S377N probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spink5 A T 18: 44,006,412 N614I probably damaging Het
Tert T C 13: 73,646,309 probably null Het
Thap4 T C 1: 93,749,876 Y396C probably damaging Het
Tle2 T C 10: 81,584,697 L348P probably damaging Het
Tmem104 T C 11: 115,243,486 S283P probably damaging Het
Tnn T C 1: 160,126,379 E602G possibly damaging Het
Tpm4 A G 8: 72,147,094 K190R probably benign Het
Ugt3a2 T C 15: 9,365,287 W329R probably damaging Het
Unc13a G A 8: 71,641,477 Q1327* probably null Het
Vmn1r194 C T 13: 22,244,888 T225I probably benign Het
Vmn1r215 T C 13: 23,076,551 S254P probably damaging Het
Vmn2r109 T C 17: 20,555,189 E92G probably damaging Het
Ythdc2 A G 18: 44,854,742 M625V probably benign Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zfp768 T C 7: 127,343,703 R418G probably damaging Het
Zmynd11 C T 13: 9,689,443 probably benign Het
Other mutations in Ttf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Ttf2 APN 3 100967097 splice site probably benign
IGL01578:Ttf2 APN 3 100956195 missense possibly damaging 0.59
IGL02218:Ttf2 APN 3 100964093 missense possibly damaging 0.61
IGL03267:Ttf2 APN 3 100944804 nonsense probably null
FR4548:Ttf2 UTSW 3 100963160 small insertion probably benign
FR4737:Ttf2 UTSW 3 100963160 small insertion probably benign
R0784:Ttf2 UTSW 3 100962710 missense probably benign 0.01
R0894:Ttf2 UTSW 3 100969549 splice site probably benign
R2083:Ttf2 UTSW 3 100969501 missense probably benign 0.18
R2125:Ttf2 UTSW 3 100948193 missense possibly damaging 0.93
R2126:Ttf2 UTSW 3 100948193 missense possibly damaging 0.93
R2230:Ttf2 UTSW 3 100957944 missense probably damaging 0.99
R3084:Ttf2 UTSW 3 100948264 missense possibly damaging 0.56
R3700:Ttf2 UTSW 3 100951008 missense probably damaging 1.00
R3963:Ttf2 UTSW 3 100941820 unclassified probably benign
R4002:Ttf2 UTSW 3 100948225 nonsense probably null
R4290:Ttf2 UTSW 3 100962761 missense probably benign 0.01
R4833:Ttf2 UTSW 3 100961406 missense probably benign 0.00
R4909:Ttf2 UTSW 3 100954315 missense probably damaging 1.00
R5523:Ttf2 UTSW 3 100959242 missense probably damaging 1.00
R5669:Ttf2 UTSW 3 100951117 nonsense probably null
R6531:Ttf2 UTSW 3 100956260 missense probably damaging 0.99
R6776:Ttf2 UTSW 3 100952553 missense probably benign 0.01
R6795:Ttf2 UTSW 3 100959262 missense probably damaging 1.00
R6861:Ttf2 UTSW 3 100969625 missense possibly damaging 0.89
R6940:Ttf2 UTSW 3 100969515 missense probably damaging 1.00
R6958:Ttf2 UTSW 3 100945932 missense probably benign 0.30
R6962:Ttf2 UTSW 3 100951137 missense probably damaging 1.00
R7211:Ttf2 UTSW 3 100959307 missense probably benign 0.00
R7365:Ttf2 UTSW 3 100963302 missense possibly damaging 0.92
R7470:Ttf2 UTSW 3 100963162 missense possibly damaging 0.85
R7534:Ttf2 UTSW 3 100950412 splice site probably null
R8023:Ttf2 UTSW 3 100956255 missense probably benign 0.01
R8087:Ttf2 UTSW 3 100964096 missense probably damaging 0.96
R8219:Ttf2 UTSW 3 100962563 missense possibly damaging 0.94
RF027:Ttf2 UTSW 3 100963157 small insertion probably benign
RF035:Ttf2 UTSW 3 100963157 small insertion probably benign
Z1177:Ttf2 UTSW 3 100959266 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAAAAGCTGGGTTTCCTTTTC -3'
(R):5'- AGCCGAGAAACCCATTTAGG -3'

Sequencing Primer
(F):5'- AAAAGCTGGGTTTCCTTTTCTCTCAG -3'
(R):5'- ACACTCGAACGAAAACAGTTTGTCG -3'
Posted On2016-06-06