Incidental Mutation 'R5011:Cops6'
ID390497
Institutional Source Beutler Lab
Gene Symbol Cops6
Ensembl Gene ENSMUSG00000019494
Gene NameCOP9 signalosome subunit 6
SynonymsSgn3, VIP/MOV34, COP9 complex S6
MMRRC Submission 042602-MU
Accession Numbers

Genbank: NM_012002; MGI: 1349439

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5011 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138161071-138164646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138162197 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 102 (D102G)
Ref Sequence ENSEMBL: ENSMUSP00000106576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000505] [ENSMUST00000019638] [ENSMUST00000110951] [ENSMUST00000132639] [ENSMUST00000148879]
Predicted Effect probably benign
Transcript: ENSMUST00000000505
SMART Domains Protein: ENSMUSP00000000505
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 48 132 1e-41 BLAST
MCM 145 642 N/A SMART
AAA 373 526 2.9e-4 SMART
Blast:MCM 658 719 1e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000019638
AA Change: D129G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000019638
Gene: ENSMUSG00000019494
AA Change: D129G

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
JAB_MPN 37 170 9.73e-35 SMART
Pfam:MitMem_reg 191 304 1.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083593
Predicted Effect probably benign
Transcript: ENSMUST00000110951
AA Change: D102G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106576
Gene: ENSMUSG00000019494
AA Change: D102G

DomainStartEndE-ValueType
JAB_MPN 10 143 9.73e-35 SMART
Pfam:MitMem_reg 163 279 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127881
Predicted Effect probably benign
Transcript: ENSMUST00000132639
SMART Domains Protein: ENSMUSP00000121554
Gene: ENSMUSG00000019494

DomainStartEndE-ValueType
Pfam:MitMem_reg 17 112 3.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148879
SMART Domains Protein: ENSMUSP00000116131
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 48 132 6e-44 BLAST
MCM 145 389 1.77e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154867
Meta Mutation Damage Score 0.0609 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein belongs to translation initiation factor 3 (eIF3) superfamily. It is involved in the regulation of cell cycle and likely to be a cellular cofactor for HIV-1 accessory gene product Vpr. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele or a transgenic gene disruption exhibit embryonic lethality. Mice heterozygous for a gene trap allele exhibit increased sensitivity to irradiation and decreased incidence of ionizing radiation-induced tumors. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Gene trapped(15)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T C 11: 107,028,498 V223A probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Atg16l1 C A 1: 87,774,180 S248* probably null Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Atxn1 T C 13: 45,557,069 N796D probably damaging Het
C3 T A 17: 57,223,236 Y455F probably benign Het
Card11 A T 5: 140,876,520 D1007E possibly damaging Het
Cbr2 T C 11: 120,730,871 D60G possibly damaging Het
Cgn T A 3: 94,776,145 E400V probably null Het
Chil3 T A 3: 106,150,161 Y229F possibly damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Clk1 T C 1: 58,414,483 I315V probably benign Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnaaf5 T A 5: 139,163,257 L437Q probably damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Draxin C A 4: 148,107,979 R292L probably damaging Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fat1 A T 8: 45,031,263 probably null Het
Fbxl18 A G 5: 142,886,680 S267P probably damaging Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Fgd2 T C 17: 29,374,980 probably null Het
Gm7251 T A 13: 49,805,180 noncoding transcript Het
Golt1a T C 1: 133,320,268 V78A probably damaging Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Gtf2ird2 G T 5: 134,216,982 S694I possibly damaging Het
H2-Ob T A 17: 34,241,279 probably null Het
Hsp90b1 T C 10: 86,696,753 D353G probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itga7 G A 10: 128,949,447 V836M possibly damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Ivns1abp T A 1: 151,363,202 M589K possibly damaging Het
Jakmip3 C T 7: 139,020,222 R284W probably damaging Het
Kank3 T C 17: 33,822,070 L512P probably damaging Het
Kcnn2 T A 18: 45,685,285 I483N possibly damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lbr A T 1: 181,819,888 Y199* probably null Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Ltbp1 T A 17: 75,066,157 L265H probably damaging Het
Maml3 A T 3: 51,690,775 N183K possibly damaging Het
Mprip T C 11: 59,759,895 V1475A possibly damaging Het
Myh4 C A 11: 67,256,363 S1611R probably benign Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nudt12 T C 17: 58,996,504 probably benign Het
Nup153 T C 13: 46,687,403 T910A possibly damaging Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Olfr391-ps T A 11: 73,799,647 T37S possibly damaging Het
Pbx2 T A 17: 34,594,699 C224* probably null Het
Pcdha6 A G 18: 36,967,907 D51G probably damaging Het
Pnpla1 C T 17: 28,885,584 T538I possibly damaging Het
Pnpla2 T C 7: 141,459,291 probably null Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ranbp2 T A 10: 58,461,895 S375T probably benign Het
Rimbp2 T C 5: 128,803,921 Y134C probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Sh3tc1 G T 5: 35,700,289 A1185D probably damaging Het
Sin3b G A 8: 72,744,556 S377N probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spink5 A T 18: 44,006,412 N614I probably damaging Het
Tert T C 13: 73,646,309 probably null Het
Thap4 T C 1: 93,749,876 Y396C probably damaging Het
Tle2 T C 10: 81,584,697 L348P probably damaging Het
Tmem104 T C 11: 115,243,486 S283P probably damaging Het
Tnn T C 1: 160,126,379 E602G possibly damaging Het
Tpm4 A G 8: 72,147,094 K190R probably benign Het
Ttf2 T C 3: 100,963,169 E196G probably benign Het
Ugt3a2 T C 15: 9,365,287 W329R probably damaging Het
Unc13a G A 8: 71,641,477 Q1327* probably null Het
Vmn1r194 C T 13: 22,244,888 T225I probably benign Het
Vmn1r215 T C 13: 23,076,551 S254P probably damaging Het
Vmn2r109 T C 17: 20,555,189 E92G probably damaging Het
Ythdc2 A G 18: 44,854,742 M625V probably benign Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zfp768 T C 7: 127,343,703 R418G probably damaging Het
Zmynd11 C T 13: 9,689,443 probably benign Het
Other mutations in Cops6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Cops6 APN 5 138163378 missense probably damaging 1.00
IGL00929:Cops6 APN 5 138161386 start codon destroyed probably null 0.02
IGL01122:Cops6 APN 5 138162373 missense probably benign 0.42
IGL02652:Cops6 APN 5 138161438 unclassified probably null
R0593:Cops6 UTSW 5 138163580 missense probably benign 0.18
R2271:Cops6 UTSW 5 138161141 missense probably benign 0.00
R5294:Cops6 UTSW 5 138161116 unclassified probably benign
R5394:Cops6 UTSW 5 138163500 splice site probably null
R6225:Cops6 UTSW 5 138161411 missense possibly damaging 0.91
R6526:Cops6 UTSW 5 138163900 unclassified probably null
R6943:Cops6 UTSW 5 138163528 missense probably benign 0.43
R7242:Cops6 UTSW 5 138163580 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GGTCAGAAGTTCAAGGTTAGTTAGG -3'
(R):5'- GGGTCAACAACACTCACATCTG -3'

Sequencing Primer
(F):5'- AGGTGTAGTTATTTTAAACTGACCC -3'
(R):5'- GTGCTTGGTCATAGGGTTCAAC -3'
Posted On2016-06-06