Incidental Mutation 'R5011:Fam149b'
ID390537
Institutional Source Beutler Lab
Gene Symbol Fam149b
Ensembl Gene ENSMUSG00000039599
Gene Namefamily with sequence similarity 149, member B
Synonyms
MMRRC Submission 042602-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R5011 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20348162-20383491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20363371 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 219 (H219Q)
Ref Sequence ENSEMBL: ENSMUSP00000153235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037698] [ENSMUST00000051915] [ENSMUST00000090499] [ENSMUST00000090503] [ENSMUST00000224721] [ENSMUST00000224930] [ENSMUST00000225597] [ENSMUST00000225834] [ENSMUST00000225942] [ENSMUST00000225991]
Predicted Effect probably benign
Transcript: ENSMUST00000037698
AA Change: H180Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000045247
Gene: ENSMUSG00000039599
AA Change: H180Q

DomainStartEndE-ValueType
Pfam:DUF3719 116 183 2.1e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000051915
AA Change: H219Q

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056907
Gene: ENSMUSG00000039599
AA Change: H219Q

DomainStartEndE-ValueType
Pfam:DUF3719 116 183 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090499
AA Change: H273Q

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000087985
Gene: ENSMUSG00000039599
AA Change: H273Q

DomainStartEndE-ValueType
Pfam:DUF3719 116 181 1.5e-28 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090503
AA Change: H180Q

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087989
Gene: ENSMUSG00000039599
AA Change: H180Q

DomainStartEndE-ValueType
Pfam:DUF3719 116 157 5.7e-14 PFAM
low complexity region 276 290 N/A INTRINSIC
low complexity region 311 322 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224670
Predicted Effect probably benign
Transcript: ENSMUST00000224721
AA Change: H273Q

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224930
AA Change: H219Q

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225363
Predicted Effect probably benign
Transcript: ENSMUST00000225597
Predicted Effect probably benign
Transcript: ENSMUST00000225834
Predicted Effect probably benign
Transcript: ENSMUST00000225942
AA Change: H273Q

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000225991
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (104/104)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T C 11: 107,028,498 V223A probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Atg16l1 C A 1: 87,774,180 S248* probably null Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Atxn1 T C 13: 45,557,069 N796D probably damaging Het
C3 T A 17: 57,223,236 Y455F probably benign Het
Card11 A T 5: 140,876,520 D1007E possibly damaging Het
Cbr2 T C 11: 120,730,871 D60G possibly damaging Het
Cgn T A 3: 94,776,145 E400V probably null Het
Chil3 T A 3: 106,150,161 Y229F possibly damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Clk1 T C 1: 58,414,483 I315V probably benign Het
Cops6 A G 5: 138,162,197 D102G probably benign Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnaaf5 T A 5: 139,163,257 L437Q probably damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Draxin C A 4: 148,107,979 R292L probably damaging Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fat1 A T 8: 45,031,263 probably null Het
Fbxl18 A G 5: 142,886,680 S267P probably damaging Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Fgd2 T C 17: 29,374,980 probably null Het
Gm7251 T A 13: 49,805,180 noncoding transcript Het
Golt1a T C 1: 133,320,268 V78A probably damaging Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Gtf2ird2 G T 5: 134,216,982 S694I possibly damaging Het
H2-Ob T A 17: 34,241,279 probably null Het
Hsp90b1 T C 10: 86,696,753 D353G probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itga7 G A 10: 128,949,447 V836M possibly damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Ivns1abp T A 1: 151,363,202 M589K possibly damaging Het
Jakmip3 C T 7: 139,020,222 R284W probably damaging Het
Kank3 T C 17: 33,822,070 L512P probably damaging Het
Kcnn2 T A 18: 45,685,285 I483N possibly damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lbr A T 1: 181,819,888 Y199* probably null Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Ltbp1 T A 17: 75,066,157 L265H probably damaging Het
Maml3 A T 3: 51,690,775 N183K possibly damaging Het
Mprip T C 11: 59,759,895 V1475A possibly damaging Het
Myh4 C A 11: 67,256,363 S1611R probably benign Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nudt12 T C 17: 58,996,504 probably benign Het
Nup153 T C 13: 46,687,403 T910A possibly damaging Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Olfr391-ps T A 11: 73,799,647 T37S possibly damaging Het
Pbx2 T A 17: 34,594,699 C224* probably null Het
Pcdha6 A G 18: 36,967,907 D51G probably damaging Het
Pnpla1 C T 17: 28,885,584 T538I possibly damaging Het
Pnpla2 T C 7: 141,459,291 probably null Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ranbp2 T A 10: 58,461,895 S375T probably benign Het
Rimbp2 T C 5: 128,803,921 Y134C probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Sh3tc1 G T 5: 35,700,289 A1185D probably damaging Het
Sin3b G A 8: 72,744,556 S377N probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spink5 A T 18: 44,006,412 N614I probably damaging Het
Tert T C 13: 73,646,309 probably null Het
Thap4 T C 1: 93,749,876 Y396C probably damaging Het
Tle2 T C 10: 81,584,697 L348P probably damaging Het
Tmem104 T C 11: 115,243,486 S283P probably damaging Het
Tnn T C 1: 160,126,379 E602G possibly damaging Het
Tpm4 A G 8: 72,147,094 K190R probably benign Het
Ttf2 T C 3: 100,963,169 E196G probably benign Het
Ugt3a2 T C 15: 9,365,287 W329R probably damaging Het
Unc13a G A 8: 71,641,477 Q1327* probably null Het
Vmn1r194 C T 13: 22,244,888 T225I probably benign Het
Vmn1r215 T C 13: 23,076,551 S254P probably damaging Het
Vmn2r109 T C 17: 20,555,189 E92G probably damaging Het
Ythdc2 A G 18: 44,854,742 M625V probably benign Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zfp768 T C 7: 127,343,703 R418G probably damaging Het
Zmynd11 C T 13: 9,689,443 probably benign Het
Other mutations in Fam149b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Fam149b APN 14 20377881 missense possibly damaging 0.78
IGL02323:Fam149b APN 14 20363301 missense possibly damaging 0.94
IGL02631:Fam149b APN 14 20375546 missense probably damaging 0.97
IGL03208:Fam149b APN 14 20351302 splice site probably benign
R0334:Fam149b UTSW 14 20363424 missense probably damaging 0.97
R2511:Fam149b UTSW 14 20378456 missense probably damaging 1.00
R2566:Fam149b UTSW 14 20375510 missense probably damaging 0.97
R4659:Fam149b UTSW 14 20367873 missense probably benign 0.16
R5013:Fam149b UTSW 14 20363371 missense possibly damaging 0.92
R5583:Fam149b UTSW 14 20363300 missense possibly damaging 0.66
R5791:Fam149b UTSW 14 20351326 missense probably damaging 0.96
R5905:Fam149b UTSW 14 20359910 missense probably benign 0.30
R6035:Fam149b UTSW 14 20377917 missense probably damaging 1.00
R6035:Fam149b UTSW 14 20377917 missense probably damaging 1.00
R7180:Fam149b UTSW 14 20381785 missense probably benign 0.01
R7210:Fam149b UTSW 14 20378472 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCACATTTCCGAGTGTCACG -3'
(R):5'- GCATTTAAGCCCTGACGTCTTAG -3'

Sequencing Primer
(F):5'- ACGGACAGTGGTGGTGC -3'
(R):5'- TTTGCCTAGTACACACAGGG -3'
Posted On2016-06-06