Incidental Mutation 'R0437:Itga10'
ID 39055
Institutional Source Beutler Lab
Gene Symbol Itga10
Ensembl Gene ENSMUSG00000090210
Gene Name integrin, alpha 10
Synonyms
MMRRC Submission 038638-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R0437 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 96552900-96571835 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96556453 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 196 (F196S)
Ref Sequence ENSEMBL: ENSMUSP00000112393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000048766] [ENSMUST00000118557] [ENSMUST00000119365] [ENSMUST00000137564] [ENSMUST00000165842]
AlphaFold E9Q6R1
Predicted Effect probably damaging
Transcript: ENSMUST00000029744
AA Change: F196S

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: F196S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1123 1145 N/A INTRINSIC
low complexity region 1153 1166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048766
SMART Domains Protein: ENSMUSP00000037962
Gene: ENSMUSG00000028102

DomainStartEndE-ValueType
Pfam:PEX11 1 251 1.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118557
SMART Domains Protein: ENSMUSP00000113365
Gene: ENSMUSG00000028102

DomainStartEndE-ValueType
Pfam:PEX11 1 251 8.3e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119365
AA Change: F196S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: F196S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1122 1144 N/A INTRINSIC
low complexity region 1152 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137564
SMART Domains Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

DomainStartEndE-ValueType
Pfam:PEX11 1 172 4.5e-57 PFAM
low complexity region 186 204 N/A INTRINSIC
Int_alpha 222 278 9.03e-3 SMART
Blast:VWA 292 345 3e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144962
Predicted Effect probably benign
Transcript: ENSMUST00000165842
SMART Domains Protein: ENSMUSP00000126631
Gene: ENSMUSG00000028102

DomainStartEndE-ValueType
Pfam:PEX11 3 237 8.9e-69 PFAM
Meta Mutation Damage Score 0.1577 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G A 13: 119,606,631 (GRCm39) R291K probably benign Het
Abca2 T C 2: 25,332,857 (GRCm39) S1519P probably damaging Het
Abcb11 G A 2: 69,087,639 (GRCm39) A1042V probably damaging Het
Abcc10 A T 17: 46,623,845 (GRCm39) probably null Het
Abcc10 G T 17: 46,623,846 (GRCm39) probably benign Het
Alkbh3 A C 2: 93,811,914 (GRCm39) L240V probably damaging Het
Apol10b T C 15: 77,469,608 (GRCm39) S190G probably benign Het
Atp1a3 C A 7: 24,698,392 (GRCm39) C135F probably benign Het
Atp4a C G 7: 30,419,526 (GRCm39) R659G probably benign Het
Bicra A G 7: 15,722,687 (GRCm39) S277P possibly damaging Het
Bltp1 A T 3: 37,043,953 (GRCm39) H2820L possibly damaging Het
Bmp8a T C 4: 123,210,690 (GRCm39) E275G probably benign Het
Ccdc102a T C 8: 95,640,054 (GRCm39) E80G probably damaging Het
Cdh23 T C 10: 60,246,576 (GRCm39) D954G probably damaging Het
Chrm4 A G 2: 91,758,788 (GRCm39) T399A possibly damaging Het
Clcn3 A G 8: 61,387,571 (GRCm39) V199A possibly damaging Het
Crlf1 T C 8: 70,952,164 (GRCm39) probably null Het
Crx G T 7: 15,605,071 (GRCm39) S57* probably null Het
Cstpp1 A G 2: 91,252,298 (GRCm39) L21P probably damaging Het
Cyp4f16 A G 17: 32,756,072 (GRCm39) I34V possibly damaging Het
Daxx T C 17: 34,132,598 (GRCm39) V576A probably benign Het
Ddx17 C T 15: 79,421,672 (GRCm39) R351H probably damaging Het
Dhx38 T C 8: 110,285,261 (GRCm39) probably benign Het
Dnd1 T C 18: 36,897,552 (GRCm39) probably benign Het
Dync1i2 A T 2: 71,058,169 (GRCm39) probably null Het
E2f6 T C 12: 16,866,446 (GRCm39) S52P probably benign Het
Epb41l4a A G 18: 34,013,326 (GRCm39) F116S probably damaging Het
Ext1 T C 15: 52,969,502 (GRCm39) N362S probably damaging Het
Fam227a C A 15: 79,528,189 (GRCm39) K79N possibly damaging Het
Fam228a T A 12: 4,782,759 (GRCm39) L111F probably damaging Het
Fat2 T C 11: 55,173,625 (GRCm39) T2363A probably benign Het
Fat3 A T 9: 15,908,228 (GRCm39) N2591K probably damaging Het
Frem2 A G 3: 53,560,436 (GRCm39) M1357T possibly damaging Het
Frmd4b A T 6: 97,400,424 (GRCm39) V29D probably damaging Het
G930045G22Rik A G 6: 50,823,918 (GRCm39) noncoding transcript Het
Galnt3 A G 2: 65,937,573 (GRCm39) S46P possibly damaging Het
Gmeb2 A G 2: 180,895,766 (GRCm39) V468A possibly damaging Het
Herc2 C T 7: 55,869,563 (GRCm39) R4271* probably null Het
Il5 C A 11: 53,614,733 (GRCm39) probably benign Het
Ints9 G A 14: 65,223,818 (GRCm39) probably benign Het
Itgb3bp T C 4: 99,670,126 (GRCm39) T138A probably damaging Het
Kcnd1 G A X: 7,690,922 (GRCm39) V281M probably benign Het
Lcp2 T C 11: 34,037,229 (GRCm39) L391P probably benign Het
Lrrc66 T C 5: 73,765,030 (GRCm39) Y671C probably benign Het
Mettl23 T C 11: 116,740,120 (GRCm39) V197A possibly damaging Het
Mmp15 C A 8: 96,097,400 (GRCm39) D456E probably benign Het
Mospd4 T C 18: 46,598,848 (GRCm39) noncoding transcript Het
Mov10l1 C A 15: 88,889,515 (GRCm39) H484N probably damaging Het
Mphosph9 T C 5: 124,453,631 (GRCm39) Q197R probably benign Het
Ms4a1 T A 19: 11,233,933 (GRCm39) probably null Het
Mybbp1a T C 11: 72,339,674 (GRCm39) V919A possibly damaging Het
Mycbpap A T 11: 94,404,338 (GRCm39) probably benign Het
Naip6 G A 13: 100,433,432 (GRCm39) S1135F possibly damaging Het
Ndufc2 T A 7: 97,049,544 (GRCm39) M50K probably benign Het
Npr2 T C 4: 43,648,082 (GRCm39) V842A probably damaging Het
Ntsr2 G T 12: 16,703,696 (GRCm39) G66W probably damaging Het
Obscn T C 11: 58,885,914 (GRCm39) probably benign Het
Optn C T 2: 5,028,926 (GRCm39) G526R probably damaging Het
Or4c11 T A 2: 88,695,229 (GRCm39) N93K probably benign Het
Or4c114 T A 2: 88,904,956 (GRCm39) I160F probably benign Het
Or6c33 T C 10: 129,853,965 (GRCm39) V245A probably damaging Het
Or6k14 G A 1: 173,927,965 (GRCm39) G314R probably benign Het
Otud4 T A 8: 80,396,626 (GRCm39) H628Q probably benign Het
Padi6 T C 4: 140,456,240 (GRCm39) T585A probably benign Het
Pex16 G T 2: 92,205,937 (GRCm39) R10L probably damaging Het
Pitpnm2 A G 5: 124,269,152 (GRCm39) probably benign Het
Pom121l2 A G 13: 22,167,375 (GRCm39) T549A possibly damaging Het
Prdm15 A T 16: 97,613,759 (GRCm39) M470K probably benign Het
Prkag2 T A 5: 25,233,503 (GRCm39) D49V possibly damaging Het
Prl3c1 A G 13: 27,383,447 (GRCm39) M38V probably benign Het
Prpf18 T A 2: 4,648,572 (GRCm39) I85F possibly damaging Het
Psg27 A G 7: 18,294,636 (GRCm39) probably benign Het
Relt A G 7: 100,497,991 (GRCm39) probably benign Het
Rskr T C 11: 78,182,362 (GRCm39) L57P probably benign Het
Serpina3b A T 12: 104,096,929 (GRCm39) N70I probably damaging Het
Slc19a3 T C 1: 83,000,286 (GRCm39) S244G probably benign Het
Slc39a5 T C 10: 128,235,716 (GRCm39) T81A possibly damaging Het
Slc7a2 G A 8: 41,357,563 (GRCm39) G277D probably damaging Het
Slc9c1 C T 16: 45,420,250 (GRCm39) probably benign Het
Slx1b A G 7: 126,291,753 (GRCm39) F104L probably benign Het
Smg6 G A 11: 74,820,527 (GRCm39) S266N probably damaging Het
Spata9 T C 13: 76,146,614 (GRCm39) V162A possibly damaging Het
Szrd1 T C 4: 140,846,055 (GRCm39) I47V probably benign Het
Tha1 G T 11: 117,759,401 (GRCm39) L363M probably benign Het
Tmc6 G A 11: 117,669,087 (GRCm39) T89I possibly damaging Het
Tmem132d C T 5: 127,866,849 (GRCm39) G684R probably damaging Het
Trim55 G A 3: 19,725,142 (GRCm39) G220S probably benign Het
Ttn A G 2: 76,600,874 (GRCm39) L18836P probably damaging Het
Ubn1 G T 16: 4,890,048 (GRCm39) probably benign Het
Ush2a T G 1: 188,643,228 (GRCm39) W4197G probably benign Het
Vmn1r189 A T 13: 22,286,231 (GRCm39) V202E probably damaging Het
Vmn1r209 T C 13: 22,990,526 (GRCm39) I55V probably benign Het
Vmn2r86 A T 10: 130,282,412 (GRCm39) C735S probably damaging Het
Vwf A T 6: 125,543,281 (GRCm39) D174V probably damaging Het
Zfp438 T C 18: 5,214,910 (GRCm39) N16S probably damaging Het
Zfp444 C T 7: 6,192,408 (GRCm39) T142I probably benign Het
Zfp804a A G 2: 81,884,135 (GRCm39) M1V probably null Het
Zfp936 T G 7: 42,838,734 (GRCm39) I67S probably benign Het
Zfp948 A T 17: 21,807,260 (GRCm39) N151Y unknown Het
Other mutations in Itga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Itga10 APN 3 96,554,957 (GRCm39) missense probably damaging 0.96
IGL01694:Itga10 APN 3 96,559,833 (GRCm39) missense probably damaging 0.99
IGL01754:Itga10 APN 3 96,564,091 (GRCm39) unclassified probably benign
IGL02527:Itga10 APN 3 96,562,940 (GRCm39) unclassified probably benign
IGL02956:Itga10 APN 3 96,562,429 (GRCm39) missense possibly damaging 0.46
IGL03371:Itga10 APN 3 96,562,104 (GRCm39) missense possibly damaging 0.84
IGL03055:Itga10 UTSW 3 96,557,836 (GRCm39) missense probably damaging 0.99
PIT4515001:Itga10 UTSW 3 96,569,948 (GRCm39) missense probably damaging 0.99
R0153:Itga10 UTSW 3 96,561,016 (GRCm39) missense probably benign 0.00
R0308:Itga10 UTSW 3 96,558,780 (GRCm39) missense probably damaging 1.00
R0331:Itga10 UTSW 3 96,559,799 (GRCm39) missense probably damaging 1.00
R0413:Itga10 UTSW 3 96,556,375 (GRCm39) missense probably damaging 1.00
R0511:Itga10 UTSW 3 96,565,490 (GRCm39) missense probably damaging 1.00
R0630:Itga10 UTSW 3 96,563,615 (GRCm39) unclassified probably benign
R0844:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R0849:Itga10 UTSW 3 96,559,846 (GRCm39) missense possibly damaging 0.67
R0894:Itga10 UTSW 3 96,560,976 (GRCm39) missense possibly damaging 0.69
R0919:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1027:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1341:Itga10 UTSW 3 96,559,811 (GRCm39) missense probably damaging 1.00
R1350:Itga10 UTSW 3 96,564,793 (GRCm39) missense probably benign 0.01
R1370:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1467:Itga10 UTSW 3 96,559,545 (GRCm39) nonsense probably null
R1467:Itga10 UTSW 3 96,559,545 (GRCm39) nonsense probably null
R1589:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1590:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1601:Itga10 UTSW 3 96,560,974 (GRCm39) missense possibly damaging 0.82
R1659:Itga10 UTSW 3 96,570,293 (GRCm39) missense probably damaging 0.96
R1665:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1667:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1686:Itga10 UTSW 3 96,559,141 (GRCm39) missense probably damaging 0.97
R1972:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1976:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R2020:Itga10 UTSW 3 96,559,806 (GRCm39) missense probably damaging 1.00
R2040:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R2044:Itga10 UTSW 3 96,565,006 (GRCm39) missense probably benign
R2044:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R2045:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R2060:Itga10 UTSW 3 96,562,314 (GRCm39) nonsense probably null
R2146:Itga10 UTSW 3 96,561,039 (GRCm39) missense probably damaging 1.00
R2146:Itga10 UTSW 3 96,558,808 (GRCm39) missense possibly damaging 0.59
R2170:Itga10 UTSW 3 96,557,773 (GRCm39) missense probably damaging 1.00
R2893:Itga10 UTSW 3 96,562,416 (GRCm39) missense probably benign 0.11
R2926:Itga10 UTSW 3 96,560,165 (GRCm39) missense probably damaging 1.00
R3622:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R3623:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R4416:Itga10 UTSW 3 96,565,562 (GRCm39) missense possibly damaging 0.58
R4633:Itga10 UTSW 3 96,555,020 (GRCm39) missense possibly damaging 0.92
R5074:Itga10 UTSW 3 96,559,527 (GRCm39) nonsense probably null
R5095:Itga10 UTSW 3 96,555,480 (GRCm39) missense probably benign 0.21
R5495:Itga10 UTSW 3 96,554,687 (GRCm39) missense possibly damaging 0.92
R5813:Itga10 UTSW 3 96,559,901 (GRCm39) missense probably benign 0.38
R6114:Itga10 UTSW 3 96,556,351 (GRCm39) missense probably damaging 1.00
R6172:Itga10 UTSW 3 96,554,753 (GRCm39) missense probably benign 0.18
R6275:Itga10 UTSW 3 96,565,501 (GRCm39) missense probably benign 0.36
R6298:Itga10 UTSW 3 96,564,078 (GRCm39) missense probably benign 0.00
R6433:Itga10 UTSW 3 96,565,357 (GRCm39) critical splice donor site probably null
R6841:Itga10 UTSW 3 96,564,030 (GRCm39) missense probably damaging 1.00
R6909:Itga10 UTSW 3 96,569,915 (GRCm39) missense probably benign 0.00
R6927:Itga10 UTSW 3 96,564,030 (GRCm39) missense probably damaging 1.00
R7124:Itga10 UTSW 3 96,559,081 (GRCm39) missense probably damaging 0.96
R7310:Itga10 UTSW 3 96,555,475 (GRCm39) missense probably damaging 1.00
R7387:Itga10 UTSW 3 96,560,094 (GRCm39) missense probably benign 0.11
R7464:Itga10 UTSW 3 96,555,471 (GRCm39) missense probably damaging 1.00
R7624:Itga10 UTSW 3 96,560,269 (GRCm39) missense probably benign
R7638:Itga10 UTSW 3 96,564,707 (GRCm39) splice site probably null
R7639:Itga10 UTSW 3 96,556,898 (GRCm39) missense probably benign 0.36
R7893:Itga10 UTSW 3 96,556,928 (GRCm39) missense probably damaging 1.00
R8297:Itga10 UTSW 3 96,562,116 (GRCm39) missense probably damaging 1.00
R8753:Itga10 UTSW 3 96,558,471 (GRCm39) missense probably damaging 1.00
R9526:Itga10 UTSW 3 96,564,273 (GRCm39) missense probably damaging 1.00
X0064:Itga10 UTSW 3 96,560,252 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGGACATTCTCCCTTGCTGACTAC -3'
(R):5'- GGAAGTGAACCCCTAACAGGTGTG -3'

Sequencing Primer
(F):5'- TTGCTGACTACACCCCACATC -3'
(R):5'- cccccacacaatcataaacttac -3'
Posted On 2013-05-23