Incidental Mutation 'R5011:C3'
ID390552
Institutional Source Beutler Lab
Gene Symbol C3
Ensembl Gene ENSMUSG00000024164
Gene Namecomplement component 3
Synonymscomplement factor 3, acylation stimulating protein, Plp
MMRRC Submission 042602-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5011 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location57203970-57228136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57223236 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 455 (Y455F)
Ref Sequence ENSEMBL: ENSMUSP00000024988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024988] [ENSMUST00000177425]
Predicted Effect probably benign
Transcript: ENSMUST00000024988
AA Change: Y455F

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000024988
Gene: ENSMUSG00000024164
AA Change: Y455F

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:A2M_N 130 225 3.8e-17 PFAM
A2M_N_2 456 604 5.22e-38 SMART
ANATO 693 728 5.69e-15 SMART
low complexity region 752 762 N/A INTRINSIC
A2M 770 866 5.47e-32 SMART
Pfam:Thiol-ester_cl 1000 1028 4.6e-15 PFAM
Pfam:A2M_comp 1051 1284 7.3e-60 PFAM
A2M_recep 1398 1493 3.98e-43 SMART
C345C 1533 1645 1.85e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176457
Predicted Effect probably benign
Transcript: ENSMUST00000177046
Predicted Effect probably benign
Transcript: ENSMUST00000177425
SMART Domains Protein: ENSMUSP00000135663
Gene: ENSMUSG00000024164

DomainStartEndE-ValueType
Pfam:A2M_N_2 1 55 1.6e-10 PFAM
PDB:3L5N|B 74 102 1e-9 PDB
Meta Mutation Damage Score 0.2300 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: This gene encodes complement protein C3 which plays a central role in the classical, alternative and lectin activation pathways of the complement system. The encoded preproprotein undergoes a multi-step processing to generate various functional peptides. Mice deficient in the encoded protein fail to clear bacteria from the blood stream upon infection, display diminished airway hyperresponsiveness and lung eosinophilia upon allergen-induced pulmonary allergy, and develop severe lung injury after deposition of IgG immune complexes. Deficiency of the homolog of the encoded protein in humans was found to be associated with increased susceptibility to infections, age-related macular degeneration, and atypical hemolytic uremic syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice exhibit abnormal immune responses, including increased mortality upon bacterial infection and decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T C 11: 107,028,498 V223A probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Atg16l1 C A 1: 87,774,180 S248* probably null Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Atxn1 T C 13: 45,557,069 N796D probably damaging Het
Card11 A T 5: 140,876,520 D1007E possibly damaging Het
Cbr2 T C 11: 120,730,871 D60G possibly damaging Het
Cgn T A 3: 94,776,145 E400V probably null Het
Chil3 T A 3: 106,150,161 Y229F possibly damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Clk1 T C 1: 58,414,483 I315V probably benign Het
Cops6 A G 5: 138,162,197 D102G probably benign Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnaaf5 T A 5: 139,163,257 L437Q probably damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Draxin C A 4: 148,107,979 R292L probably damaging Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fat1 A T 8: 45,031,263 probably null Het
Fbxl18 A G 5: 142,886,680 S267P probably damaging Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Fgd2 T C 17: 29,374,980 probably null Het
Gm7251 T A 13: 49,805,180 noncoding transcript Het
Golt1a T C 1: 133,320,268 V78A probably damaging Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Gtf2ird2 G T 5: 134,216,982 S694I possibly damaging Het
H2-Ob T A 17: 34,241,279 probably null Het
Hsp90b1 T C 10: 86,696,753 D353G probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itga7 G A 10: 128,949,447 V836M possibly damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Ivns1abp T A 1: 151,363,202 M589K possibly damaging Het
Jakmip3 C T 7: 139,020,222 R284W probably damaging Het
Kank3 T C 17: 33,822,070 L512P probably damaging Het
Kcnn2 T A 18: 45,685,285 I483N possibly damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lbr A T 1: 181,819,888 Y199* probably null Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Ltbp1 T A 17: 75,066,157 L265H probably damaging Het
Maml3 A T 3: 51,690,775 N183K possibly damaging Het
Mprip T C 11: 59,759,895 V1475A possibly damaging Het
Myh4 C A 11: 67,256,363 S1611R probably benign Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nudt12 T C 17: 58,996,504 probably benign Het
Nup153 T C 13: 46,687,403 T910A possibly damaging Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Olfr391-ps T A 11: 73,799,647 T37S possibly damaging Het
Pbx2 T A 17: 34,594,699 C224* probably null Het
Pcdha6 A G 18: 36,967,907 D51G probably damaging Het
Pnpla1 C T 17: 28,885,584 T538I possibly damaging Het
Pnpla2 T C 7: 141,459,291 probably null Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ranbp2 T A 10: 58,461,895 S375T probably benign Het
Rimbp2 T C 5: 128,803,921 Y134C probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Sh3tc1 G T 5: 35,700,289 A1185D probably damaging Het
Sin3b G A 8: 72,744,556 S377N probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spink5 A T 18: 44,006,412 N614I probably damaging Het
Tert T C 13: 73,646,309 probably null Het
Thap4 T C 1: 93,749,876 Y396C probably damaging Het
Tle2 T C 10: 81,584,697 L348P probably damaging Het
Tmem104 T C 11: 115,243,486 S283P probably damaging Het
Tnn T C 1: 160,126,379 E602G possibly damaging Het
Tpm4 A G 8: 72,147,094 K190R probably benign Het
Ttf2 T C 3: 100,963,169 E196G probably benign Het
Ugt3a2 T C 15: 9,365,287 W329R probably damaging Het
Unc13a G A 8: 71,641,477 Q1327* probably null Het
Vmn1r194 C T 13: 22,244,888 T225I probably benign Het
Vmn1r215 T C 13: 23,076,551 S254P probably damaging Het
Vmn2r109 T C 17: 20,555,189 E92G probably damaging Het
Ythdc2 A G 18: 44,854,742 M625V probably benign Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zfp768 T C 7: 127,343,703 R418G probably damaging Het
Zmynd11 C T 13: 9,689,443 probably benign Het
Other mutations in C3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:C3 APN 17 57226004 missense probably benign 0.01
IGL00741:C3 APN 17 57220206 intron probably benign
IGL01093:C3 APN 17 57223949 missense probably damaging 1.00
IGL01309:C3 APN 17 57209652 intron probably benign
IGL01312:C3 APN 17 57225993 unclassified probably benign
IGL01344:C3 APN 17 57224880 missense probably benign
IGL01514:C3 APN 17 57215866 missense probably benign 0.04
IGL01913:C3 APN 17 57213767 missense probably null 0.01
IGL02165:C3 APN 17 57225092 missense probably benign 0.17
IGL02176:C3 APN 17 57226337 unclassified probably benign
IGL02189:C3 APN 17 57220113 missense probably benign 0.01
IGL02378:C3 APN 17 57212698 missense probably benign 0.19
IGL02422:C3 APN 17 57226823 missense probably damaging 0.98
IGL02715:C3 APN 17 57204158 intron probably benign
IGL02737:C3 APN 17 57204281 missense probably benign 0.08
IGL03201:C3 APN 17 57222249 missense probably damaging 1.00
IGL03210:C3 APN 17 57215846 nonsense probably null
IGL03345:C3 APN 17 57219585 missense probably damaging 1.00
PIT4431001:C3 UTSW 17 57206242 missense probably benign 0.00
PIT4494001:C3 UTSW 17 57209263 missense probably benign 0.01
R0158:C3 UTSW 17 57224851 critical splice donor site probably null
R0318:C3 UTSW 17 57224709 missense probably damaging 0.99
R1132:C3 UTSW 17 57207531 critical splice donor site probably null
R1765:C3 UTSW 17 57224401 intron probably null
R1793:C3 UTSW 17 57219592 missense possibly damaging 0.93
R1852:C3 UTSW 17 57222823 missense probably damaging 0.98
R1908:C3 UTSW 17 57209489 missense probably damaging 1.00
R1919:C3 UTSW 17 57220135 missense probably damaging 1.00
R1935:C3 UTSW 17 57218829 missense probably damaging 1.00
R2026:C3 UTSW 17 57218562 missense probably damaging 1.00
R2108:C3 UTSW 17 57223974 intron probably null
R2197:C3 UTSW 17 57219623 missense probably benign 0.32
R2394:C3 UTSW 17 57222303 nonsense probably null
R2998:C3 UTSW 17 57210284 missense probably benign 0.00
R3727:C3 UTSW 17 57207379 missense possibly damaging 0.50
R3767:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3768:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3769:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3770:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3784:C3 UTSW 17 57226067 missense probably damaging 0.99
R3883:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3884:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3950:C3 UTSW 17 57225286 missense probably benign 0.02
R3966:C3 UTSW 17 57218664 missense probably damaging 0.99
R4077:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4078:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4079:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4168:C3 UTSW 17 57218608 missense probably benign 0.00
R4208:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4695:C3 UTSW 17 57221057 missense probably benign
R4909:C3 UTSW 17 57226830 critical splice donor site probably null
R5094:C3 UTSW 17 57225033 critical splice donor site probably null
R5141:C3 UTSW 17 57219570 missense probably damaging 0.98
R5170:C3 UTSW 17 57223938 missense probably damaging 0.96
R5339:C3 UTSW 17 57224308 missense probably damaging 0.99
R5369:C3 UTSW 17 57221159 missense probably benign 0.45
R5412:C3 UTSW 17 57220187 missense probably benign 0.01
R5439:C3 UTSW 17 57204502 missense probably benign 0.28
R5463:C3 UTSW 17 57211720 missense probably benign 0.08
R5546:C3 UTSW 17 57222976 missense probably damaging 0.99
R5572:C3 UTSW 17 57224673 missense probably damaging 0.99
R5851:C3 UTSW 17 57211612 missense probably null 0.14
R5863:C3 UTSW 17 57223141 missense probably benign 0.06
R5888:C3 UTSW 17 57214831 missense probably damaging 1.00
R5940:C3 UTSW 17 57210244 missense possibly damaging 0.64
R6073:C3 UTSW 17 57206223 missense probably null
R6091:C3 UTSW 17 57221967 nonsense probably null
R6286:C3 UTSW 17 57224118 missense probably damaging 1.00
R6524:C3 UTSW 17 57217264 critical splice donor site probably null
R6868:C3 UTSW 17 57204029 missense possibly damaging 0.55
R6896:C3 UTSW 17 57220864 intron probably null
R7007:C3 UTSW 17 57218809 missense probably benign 0.00
R7022:C3 UTSW 17 57217286 missense probably damaging 1.00
R7099:C3 UTSW 17 57206276 missense probably benign 0.28
R7117:C3 UTSW 17 57212655 missense probably benign 0.01
R7347:C3 UTSW 17 57223215 missense probably benign 0.09
R7366:C3 UTSW 17 57221162 missense probably benign 0.00
R7423:C3 UTSW 17 57214767 missense probably damaging 1.00
R7425:C3 UTSW 17 57204039 missense possibly damaging 0.81
R7481:C3 UTSW 17 57220136 missense probably damaging 1.00
R7540:C3 UTSW 17 57206220 missense probably benign 0.01
R7746:C3 UTSW 17 57218859 missense probably damaging 1.00
R7771:C3 UTSW 17 57215797 missense probably damaging 1.00
R7884:C3 UTSW 17 57226264 missense probably benign 0.05
R8144:C3 UTSW 17 57226276 missense probably damaging 0.98
R8279:C3 UTSW 17 57215809 missense probably benign 0.28
R8284:C3 UTSW 17 57223938 missense probably benign 0.39
Z1177:C3 UTSW 17 57217144 missense probably benign 0.07
Z1177:C3 UTSW 17 57226171 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGAATGGGTACAGGAGACCCC -3'
(R):5'- GTTTTCATGACACCTCCGTGG -3'

Sequencing Primer
(F):5'- CAGGGCTGGGCATGAATC -3'
(R):5'- AGTCCAGTCCATTATCTCAGGGGAG -3'
Posted On2016-06-06