Incidental Mutation 'R5011:Spink5'
ID390556
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Nameserine peptidase inhibitor, Kazal type 5
Synonyms2310065D10Rik, LEKT1
MMRRC Submission 042602-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5011 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location43963235-44022501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44006412 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 614 (N614I)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
Predicted Effect probably damaging
Transcript: ENSMUST00000069245
AA Change: N614I

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: N614I

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T C 11: 107,028,498 V223A probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Atg16l1 C A 1: 87,774,180 S248* probably null Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Atxn1 T C 13: 45,557,069 N796D probably damaging Het
C3 T A 17: 57,223,236 Y455F probably benign Het
Card11 A T 5: 140,876,520 D1007E possibly damaging Het
Cbr2 T C 11: 120,730,871 D60G possibly damaging Het
Cgn T A 3: 94,776,145 E400V probably null Het
Chil3 T A 3: 106,150,161 Y229F possibly damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Clk1 T C 1: 58,414,483 I315V probably benign Het
Cops6 A G 5: 138,162,197 D102G probably benign Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnaaf5 T A 5: 139,163,257 L437Q probably damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Draxin C A 4: 148,107,979 R292L probably damaging Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fat1 A T 8: 45,031,263 probably null Het
Fbxl18 A G 5: 142,886,680 S267P probably damaging Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Fgd2 T C 17: 29,374,980 probably null Het
Gm7251 T A 13: 49,805,180 noncoding transcript Het
Golt1a T C 1: 133,320,268 V78A probably damaging Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Gtf2ird2 G T 5: 134,216,982 S694I possibly damaging Het
H2-Ob T A 17: 34,241,279 probably null Het
Hsp90b1 T C 10: 86,696,753 D353G probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itga7 G A 10: 128,949,447 V836M possibly damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Ivns1abp T A 1: 151,363,202 M589K possibly damaging Het
Jakmip3 C T 7: 139,020,222 R284W probably damaging Het
Kank3 T C 17: 33,822,070 L512P probably damaging Het
Kcnn2 T A 18: 45,685,285 I483N possibly damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lbr A T 1: 181,819,888 Y199* probably null Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Ltbp1 T A 17: 75,066,157 L265H probably damaging Het
Maml3 A T 3: 51,690,775 N183K possibly damaging Het
Mprip T C 11: 59,759,895 V1475A possibly damaging Het
Myh4 C A 11: 67,256,363 S1611R probably benign Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nudt12 T C 17: 58,996,504 probably benign Het
Nup153 T C 13: 46,687,403 T910A possibly damaging Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Olfr391-ps T A 11: 73,799,647 T37S possibly damaging Het
Pbx2 T A 17: 34,594,699 C224* probably null Het
Pcdha6 A G 18: 36,967,907 D51G probably damaging Het
Pnpla1 C T 17: 28,885,584 T538I possibly damaging Het
Pnpla2 T C 7: 141,459,291 probably null Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ranbp2 T A 10: 58,461,895 S375T probably benign Het
Rimbp2 T C 5: 128,803,921 Y134C probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Sh3tc1 G T 5: 35,700,289 A1185D probably damaging Het
Sin3b G A 8: 72,744,556 S377N probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Tert T C 13: 73,646,309 probably null Het
Thap4 T C 1: 93,749,876 Y396C probably damaging Het
Tle2 T C 10: 81,584,697 L348P probably damaging Het
Tmem104 T C 11: 115,243,486 S283P probably damaging Het
Tnn T C 1: 160,126,379 E602G possibly damaging Het
Tpm4 A G 8: 72,147,094 K190R probably benign Het
Ttf2 T C 3: 100,963,169 E196G probably benign Het
Ugt3a2 T C 15: 9,365,287 W329R probably damaging Het
Unc13a G A 8: 71,641,477 Q1327* probably null Het
Vmn1r194 C T 13: 22,244,888 T225I probably benign Het
Vmn1r215 T C 13: 23,076,551 S254P probably damaging Het
Vmn2r109 T C 17: 20,555,189 E92G probably damaging Het
Ythdc2 A G 18: 44,854,742 M625V probably benign Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zfp768 T C 7: 127,343,703 R418G probably damaging Het
Zmynd11 C T 13: 9,689,443 probably benign Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice site probably benign
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 0.98
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.02
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense possibly damaging 0.74
IGL01629:Spink5 APN 18 43996610 splice site probably benign
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.02
IGL02237:Spink5 APN 18 44012867 missense probably benign 0.03
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 1.00
IGL02425:Spink5 APN 18 43990744 critical splice donor site probably null
IGL02552:Spink5 APN 18 43992168 missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.01
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.59
crusty2 UTSW 18 43999935 splice site probably benign
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.00
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice site probably null
R0648:Spink5 UTSW 18 43999797 splice site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.01
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1843:Spink5 UTSW 18 43999891 missense probably benign 0.03
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2278:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4179:Spink5 UTSW 18 43987867 missense probably benign
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5163:Spink5 UTSW 18 43999857 missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5292:Spink5 UTSW 18 44006454 missense probably benign
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44018711 missense probably damaging 0.96
R6267:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6296:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6373:Spink5 UTSW 18 43990672 missense probably damaging 1.00
R6982:Spink5 UTSW 18 43977725 missense probably damaging 1.00
R6982:Spink5 UTSW 18 44010042 splice site probably null
R7332:Spink5 UTSW 18 43982250 missense probably damaging 0.96
R7396:Spink5 UTSW 18 43977655 missense possibly damaging 0.95
R7643:Spink5 UTSW 18 44010252 missense probably benign 0.37
R7726:Spink5 UTSW 18 43963352 missense probably damaging 1.00
R7828:Spink5 UTSW 18 44010229 missense probably benign 0.15
R7836:Spink5 UTSW 18 43999821 missense probably benign 0.00
R7880:Spink5 UTSW 18 43986326 missense probably benign 0.40
R7919:Spink5 UTSW 18 43999821 missense probably benign 0.00
R7963:Spink5 UTSW 18 43986326 missense probably benign 0.40
R8031:Spink5 UTSW 18 44010236 missense probably benign 0.07
R8198:Spink5 UTSW 18 43992880 missense probably benign 0.17
Z1177:Spink5 UTSW 18 43996635 missense probably damaging 0.97
Z1177:Spink5 UTSW 18 43996697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCACAGAATTCATCTCGGG -3'
(R):5'- TTGACGGGACAGGCTTAAGTG -3'

Sequencing Primer
(F):5'- CAGAATTCATCTCGGGCATTTTACG -3'
(R):5'- GTGGAAGACTGTTCTAAAGACTTG -3'
Posted On2016-06-06