Incidental Mutation 'R5012:Fastkd2'
ID 390560
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene Name FAST kinase domains 2
Synonyms 2810421I24Rik
MMRRC Submission 042603-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5012 (G1)
Quality Score 166
Status Validated
Chromosome 1
Chromosomal Location 63730614-63754655 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to T at 63749896 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027103]
AlphaFold Q922E6
Predicted Effect probably benign
Transcript: ENSMUST00000027103
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134454
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C A 19: 3,717,217 T268K possibly damaging Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Acsl1 A G 8: 46,521,431 S314G probably benign Het
Aftph G A 11: 20,698,264 probably benign Het
Ankrd34c T G 9: 89,729,656 I211L probably benign Het
Anks1b A G 10: 90,359,137 T560A probably benign Het
Carmil1 G T 13: 24,024,420 S1247R possibly damaging Het
Elf1 T A 14: 79,570,734 Y172N probably damaging Het
Emx1 C T 6: 85,203,973 P224L probably benign Het
Fbxw27 C A 9: 109,773,203 C234F probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Igkv6-23 C A 6: 70,260,545 A71S probably damaging Het
Igsf10 A G 3: 59,318,722 L2510P probably damaging Het
Itgal T C 7: 127,299,630 probably null Het
Kmt2c C A 5: 25,299,712 G122* probably null Het
Lamtor2 C T 3: 88,552,856 R3H possibly damaging Het
Magi2 A T 5: 20,465,620 T321S probably damaging Het
Mau2 A G 8: 70,031,457 probably null Het
Mcm7 A T 5: 138,169,347 probably null Het
Mitd1 A T 1: 37,885,293 C59S probably benign Het
Muc6 A G 7: 141,636,657 L2636P possibly damaging Het
Paip1 A G 13: 119,447,802 M233V probably benign Het
Pcdhb11 C A 18: 37,422,976 T453N possibly damaging Het
Plcb1 A G 2: 135,333,400 N545S probably null Het
Prl8a9 A T 13: 27,562,611 probably null Het
Psmc2 A G 5: 21,802,565 T308A probably benign Het
Rassf2 C A 2: 132,009,690 R44L probably damaging Het
Scn11a A T 9: 119,780,878 M968K probably benign Het
Sept4 T A 11: 87,584,404 S146T possibly damaging Het
Slc41a2 A G 10: 83,301,263 I260T probably benign Het
Steap2 G C 5: 5,677,784 L184V possibly damaging Het
Ttll5 G A 12: 85,926,844 E776K possibly damaging Het
Vipr1 A T 9: 121,658,045 probably null Het
Yars2 T C 16: 16,303,584 S201P probably damaging Het
Zfp386 T A 12: 116,059,244 I194K probably benign Het
Zfp988 A G 4: 147,331,603 I165V probably benign Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63737771 splice site probably benign
IGL01890:Fastkd2 APN 1 63732161 missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63747999 missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63737924 splice site probably benign
IGL03208:Fastkd2 APN 1 63739206 missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63732028 missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63752400 missense possibly damaging 0.46
R0385:Fastkd2 UTSW 1 63737811 missense probably benign 0.01
R0486:Fastkd2 UTSW 1 63752340 missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63747955 splice site probably benign
R1468:Fastkd2 UTSW 1 63732226 unclassified probably benign
R1579:Fastkd2 UTSW 1 63745887 missense probably null 0.00
R1729:Fastkd2 UTSW 1 63751300 nonsense probably null
R3937:Fastkd2 UTSW 1 63737836 missense possibly damaging 0.48
R4326:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4327:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63735809 intron probably benign
R4473:Fastkd2 UTSW 1 63731674 missense probably damaging 0.97
R4760:Fastkd2 UTSW 1 63745886 missense probably benign 0.00
R5176:Fastkd2 UTSW 1 63731439 unclassified probably benign
R5478:Fastkd2 UTSW 1 63739186 missense probably benign 0.13
R5619:Fastkd2 UTSW 1 63739310 missense probably benign 0.25
R6893:Fastkd2 UTSW 1 63731794 missense possibly damaging 0.75
R7038:Fastkd2 UTSW 1 63731873 missense possibly damaging 0.79
R7049:Fastkd2 UTSW 1 63731850 missense probably benign 0.04
R7510:Fastkd2 UTSW 1 63737789 missense possibly damaging 0.83
R7810:Fastkd2 UTSW 1 63731692 missense possibly damaging 0.61
R7889:Fastkd2 UTSW 1 63735460 splice site probably null
R8263:Fastkd2 UTSW 1 63731809 missense probably benign 0.03
R8271:Fastkd2 UTSW 1 63748024 missense probably benign 0.26
R8321:Fastkd2 UTSW 1 63747979 missense probably benign 0.00
R8468:Fastkd2 UTSW 1 63731764 missense probably benign 0.06
R8767:Fastkd2 UTSW 1 63735921 missense probably benign 0.00
Z1177:Fastkd2 UTSW 1 63734836 critical splice donor site probably null
Z1177:Fastkd2 UTSW 1 63734837 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGATACTAACAGGACCCAAGTATTTTC -3'
(R):5'- GATGCCTCAAGTTTATGGTCAC -3'

Sequencing Primer
(F):5'- CAGGACCCAAGTATTTTCATTTTCTG -3'
(R):5'- GCTGAAGTTTACACTGCATCGACAG -3'
Posted On 2016-06-06