Incidental Mutation 'R5012:Acsl1'
ID390574
Institutional Source Beutler Lab
Gene Symbol Acsl1
Ensembl Gene ENSMUSG00000018796
Gene Nameacyl-CoA synthetase long-chain family member 1
SynonymsFacl2, Acas1
MMRRC Submission 042603-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock #R5012 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46471037-46536051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46521431 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 314 (S314G)
Ref Sequence ENSEMBL: ENSMUSP00000106000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034046] [ENSMUST00000110371] [ENSMUST00000110372]
Predicted Effect probably benign
Transcript: ENSMUST00000034046
SMART Domains Protein: ENSMUSP00000034046
Gene: ENSMUSG00000018796

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 97 564 7.9e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110371
AA Change: S314G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000106000
Gene: ENSMUSG00000018796
AA Change: S314G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 97 564 4.1e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110372
SMART Domains Protein: ENSMUSP00000106001
Gene: ENSMUSG00000018796

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 101 564 9.7e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210929
Meta Mutation Damage Score 0.0822 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a family of acyl coenzyme A synthetase proteins, which convert long chain fatty acids to acyl CoA products via an ATP-dependent pathway. This enzyme is enriched in heart, liver and adipose tissue, where it functions in lipid synthesis and mitochondrial and peroxisomal beta-oxidation. In addition, it is expressed in monocytes and macrophages where it appears to have a functionally distinct role in mediating inflammatory and innate immune responses. A pseudogene of this gene is found on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Liver acyl-CoA levels are reduced when this gene is conditionally knocked out in the liver. Impaired adaptive thermogenesis when this gene is conditionally knocked out in adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C A 19: 3,717,217 T268K possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aftph G A 11: 20,698,264 probably benign Het
Ankrd34c T G 9: 89,729,656 I211L probably benign Het
Anks1b A G 10: 90,359,137 T560A probably benign Het
Carmil1 G T 13: 24,024,420 S1247R possibly damaging Het
Elf1 T A 14: 79,570,734 Y172N probably damaging Het
Emx1 C T 6: 85,203,973 P224L probably benign Het
Fastkd2 A T 1: 63,749,896 probably benign Het
Fbxw27 C A 9: 109,773,203 C234F probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Igkv6-23 C A 6: 70,260,545 A71S probably damaging Het
Igsf10 A G 3: 59,318,722 L2510P probably damaging Het
Itgal T C 7: 127,299,630 probably null Het
Kmt2c C A 5: 25,299,712 G122* probably null Het
Lamtor2 C T 3: 88,552,856 R3H possibly damaging Het
Magi2 A T 5: 20,465,620 T321S probably damaging Het
Mau2 A G 8: 70,031,457 probably null Het
Mcm7 A T 5: 138,169,347 probably null Het
Mitd1 A T 1: 37,885,293 C59S probably benign Het
Muc6 A G 7: 141,636,657 L2636P possibly damaging Het
Paip1 A G 13: 119,447,802 M233V probably benign Het
Pcdhb11 C A 18: 37,422,976 T453N possibly damaging Het
Plcb1 A G 2: 135,333,400 N545S probably null Het
Prl8a9 A T 13: 27,562,611 probably null Het
Psmc2 A G 5: 21,802,565 T308A probably benign Het
Rassf2 C A 2: 132,009,690 R44L probably damaging Het
Scn11a A T 9: 119,780,878 M968K probably benign Het
Sept4 T A 11: 87,584,404 S146T possibly damaging Het
Slc41a2 A G 10: 83,301,263 I260T probably benign Het
Steap2 G C 5: 5,677,784 L184V possibly damaging Het
Ttll5 G A 12: 85,926,844 E776K possibly damaging Het
Vipr1 A T 9: 121,658,045 probably null Het
Yars2 T C 16: 16,303,584 S201P probably damaging Het
Zfp386 T A 12: 116,059,244 I194K probably benign Het
Zfp988 A G 4: 147,331,603 I165V probably benign Het
Other mutations in Acsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Acsl1 APN 8 46513760 unclassified probably benign
IGL01356:Acsl1 APN 8 46511463 critical splice donor site probably null
IGL02227:Acsl1 APN 8 46534365 missense probably benign 0.40
IGL02812:Acsl1 APN 8 46492836 missense possibly damaging 0.47
IGL03061:Acsl1 APN 8 46508337 missense probably damaging 0.97
IGL03329:Acsl1 APN 8 46492994 missense possibly damaging 0.88
R0019:Acsl1 UTSW 8 46521250 intron probably null
R0190:Acsl1 UTSW 8 46513392 critical splice donor site probably null
R0233:Acsl1 UTSW 8 46513569 unclassified probably benign
R0479:Acsl1 UTSW 8 46531072 missense probably damaging 1.00
R1325:Acsl1 UTSW 8 46513300 missense probably benign
R1930:Acsl1 UTSW 8 46530986 missense probably benign 0.21
R1931:Acsl1 UTSW 8 46530986 missense probably benign 0.21
R2035:Acsl1 UTSW 8 46528584 missense probably damaging 1.00
R2126:Acsl1 UTSW 8 46533626 missense probably benign 0.01
R2167:Acsl1 UTSW 8 46533590 missense possibly damaging 0.91
R3051:Acsl1 UTSW 8 46521337 missense probably benign 0.00
R3052:Acsl1 UTSW 8 46521337 missense probably benign 0.00
R3753:Acsl1 UTSW 8 46513565 unclassified probably benign
R3883:Acsl1 UTSW 8 46527191 missense probably benign 0.19
R3956:Acsl1 UTSW 8 46534458 missense probably damaging 1.00
R4622:Acsl1 UTSW 8 46526373 missense probably benign 0.02
R5168:Acsl1 UTSW 8 46513266 unclassified probably benign
R5464:Acsl1 UTSW 8 46505738 missense probably benign
R5678:Acsl1 UTSW 8 46492850 missense probably benign 0.03
R7151:Acsl1 UTSW 8 46513597 missense probably damaging 1.00
R7831:Acsl1 UTSW 8 46519006 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGAGTGCATTCATCGCTTC -3'
(R):5'- ACTCTGGATTCTAAACTGCAGG -3'

Sequencing Primer
(F):5'- GCATTCATCGCTTCCACAGATGATG -3'
(R):5'- CTGCAGGATTAAAGTTCAAATACCC -3'
Posted On2016-06-06