Incidental Mutation 'R5012:Yars2'
ID390595
Institutional Source Beutler Lab
Gene Symbol Yars2
Ensembl Gene ENSMUSG00000022792
Gene Nametyrosyl-tRNA synthetase 2 (mitochondrial)
Synonyms2210023C10Rik
MMRRC Submission 042603-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R5012 (G1)
Quality Score196
Status Validated
Chromosome16
Chromosomal Location16302965-16309640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16303584 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 201 (S201P)
Ref Sequence ENSEMBL: ENSMUSP00000125252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059955] [ENSMUST00000159683] [ENSMUST00000159962] [ENSMUST00000162734]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059955
AA Change: S201P

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055277
Gene: ENSMUSG00000022792
AA Change: S201P

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 370 5.9e-74 PFAM
Blast:S4 403 466 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159583
Predicted Effect probably damaging
Transcript: ENSMUST00000159683
AA Change: S201P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124606
Gene: ENSMUSG00000022792
AA Change: S201P

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 332 1.4e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159962
AA Change: S201P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125252
Gene: ENSMUSG00000022792
AA Change: S201P

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 332 1.4e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161191
Predicted Effect probably benign
Transcript: ENSMUST00000162734
SMART Domains Protein: ENSMUSP00000125496
Gene: ENSMUSG00000022792

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 1 102 7.2e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that catalyzes the attachment of tyrosine to tRNA(Tyr). Mutations in this gene are associated with myopathy with lactic acidosis and sideroblastic anemia type 2 (MLASA2). [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C A 19: 3,717,217 T268K possibly damaging Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Acsl1 A G 8: 46,521,431 S314G probably benign Het
Aftph G A 11: 20,698,264 probably benign Het
Ankrd34c T G 9: 89,729,656 I211L probably benign Het
Anks1b A G 10: 90,359,137 T560A probably benign Het
Carmil1 G T 13: 24,024,420 S1247R possibly damaging Het
Elf1 T A 14: 79,570,734 Y172N probably damaging Het
Emx1 C T 6: 85,203,973 P224L probably benign Het
Fastkd2 A T 1: 63,749,896 probably benign Het
Fbxw27 C A 9: 109,773,203 C234F probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Igkv6-23 C A 6: 70,260,545 A71S probably damaging Het
Igsf10 A G 3: 59,318,722 L2510P probably damaging Het
Itgal T C 7: 127,299,630 probably null Het
Kmt2c C A 5: 25,299,712 G122* probably null Het
Lamtor2 C T 3: 88,552,856 R3H possibly damaging Het
Magi2 A T 5: 20,465,620 T321S probably damaging Het
Mau2 A G 8: 70,031,457 probably null Het
Mcm7 A T 5: 138,169,347 probably null Het
Mitd1 A T 1: 37,885,293 C59S probably benign Het
Muc6 A G 7: 141,636,657 L2636P possibly damaging Het
Paip1 A G 13: 119,447,802 M233V probably benign Het
Pcdhb11 C A 18: 37,422,976 T453N possibly damaging Het
Plcb1 A G 2: 135,333,400 N545S probably null Het
Prl8a9 A T 13: 27,562,611 probably null Het
Psmc2 A G 5: 21,802,565 T308A probably benign Het
Rassf2 C A 2: 132,009,690 R44L probably damaging Het
Scn11a A T 9: 119,780,878 M968K probably benign Het
Sept4 T A 11: 87,584,404 S146T possibly damaging Het
Slc41a2 A G 10: 83,301,263 I260T probably benign Het
Steap2 G C 5: 5,677,784 L184V possibly damaging Het
Ttll5 G A 12: 85,926,844 E776K possibly damaging Het
Vipr1 A T 9: 121,658,045 probably null Het
Zfp386 T A 12: 116,059,244 I194K probably benign Het
Zfp988 A G 4: 147,331,603 I165V probably benign Het
Other mutations in Yars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Yars2 APN 16 16303321 missense probably damaging 0.99
IGL01061:Yars2 APN 16 16306542 nonsense probably null
IGL01062:Yars2 APN 16 16306542 nonsense probably null
IGL01063:Yars2 APN 16 16306542 nonsense probably null
IGL01066:Yars2 APN 16 16306542 nonsense probably null
IGL01069:Yars2 APN 16 16306542 nonsense probably null
IGL01070:Yars2 APN 16 16306542 nonsense probably null
IGL02928:Yars2 APN 16 16303546 missense probably damaging 1.00
R4718:Yars2 UTSW 16 16309340 missense probably benign 0.00
R5498:Yars2 UTSW 16 16306523 missense possibly damaging 0.62
R5585:Yars2 UTSW 16 16304620 missense probably damaging 1.00
R5935:Yars2 UTSW 16 16309471 missense probably benign 0.02
R6302:Yars2 UTSW 16 16304574 missense probably damaging 1.00
R6344:Yars2 UTSW 16 16303035 missense probably benign
R7218:Yars2 UTSW 16 16303318 missense probably damaging 1.00
R7235:Yars2 UTSW 16 16304692 missense probably benign
R7921:Yars2 UTSW 16 16304521 splice site probably null
X0062:Yars2 UTSW 16 16303018 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GCTAACTCTGTTGGGGCTCTTC -3'
(R):5'- CAGCTTACTTGTGGATGAACTC -3'

Sequencing Primer
(F):5'- ACAACGTGATCGCGCTC -3'
(R):5'- ACTCGTAGCCAGACATGATGTTG -3'
Posted On2016-06-06