Incidental Mutation 'R5013:Gsn'
ID390607
Institutional Source Beutler Lab
Gene Symbol Gsn
Ensembl Gene ENSMUSG00000026879
Gene Namegelsolin
Synonyms
MMRRC Submission 042604-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.641) question?
Stock #R5013 (G1)
Quality Score183
Status Validated
Chromosome2
Chromosomal Location35256380-35307892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35298921 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 440 (Y440N)
Ref Sequence ENSEMBL: ENSMUSP00000144561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028239] [ENSMUST00000201185] [ENSMUST00000202990]
Predicted Effect probably damaging
Transcript: ENSMUST00000028239
AA Change: Y489N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028239
Gene: ENSMUSG00000026879
AA Change: Y489N

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
GEL 64 162 7.31e-30 SMART
GEL 183 275 1.53e-32 SMART
GEL 299 394 2.59e-30 SMART
GEL 443 540 9.28e-32 SMART
GEL 561 646 1.67e-24 SMART
GEL 666 761 4.04e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201185
AA Change: Y440N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144561
Gene: ENSMUSG00000026879
AA Change: Y440N

DomainStartEndE-ValueType
GEL 15 113 4.9e-32 SMART
GEL 134 226 9.6e-35 SMART
GEL 250 345 1.6e-32 SMART
GEL 394 491 5.8e-34 SMART
GEL 512 597 1.1e-26 SMART
GEL 617 712 2.7e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202990
AA Change: Y451N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144296
Gene: ENSMUSG00000026879
AA Change: Y451N

DomainStartEndE-ValueType
GEL 26 124 4.9e-32 SMART
GEL 145 237 9.6e-35 SMART
GEL 261 356 1.6e-32 SMART
GEL 405 502 5.8e-34 SMART
Meta Mutation Damage Score 0.508 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the "plus" ends of actin monomers and filaments to prevent monomer exchange. The encoded calcium-regulated protein functions in both assembly and disassembly of actin filaments. Defects in this gene are a cause of familial amyloidosis Finnish type (FAF). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in the immune system, platelet and platelet function, bone density, nervous and circulatory system. In addition, there are background related effects on viability and mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Abca12 A G 1: 71,264,767 L2117P probably damaging Het
Ago3 A T 4: 126,368,598 S386R probably benign Het
Agxt T C 1: 93,142,057 probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Anxa1 A G 19: 20,382,923 V108A probably benign Het
Aqp3 A G 4: 41,093,819 F225L probably damaging Het
Atp11b T G 3: 35,834,383 I934R possibly damaging Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Bcr A G 10: 75,125,066 D443G probably benign Het
Cbfa2t3 G T 8: 122,638,859 D211E possibly damaging Het
Ccdc146 A T 5: 21,333,038 L96Q probably damaging Het
Cdh16 A G 8: 104,617,028 I612T probably damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajc2 G A 5: 21,757,773 R521* probably null Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fbxw17 C T 13: 50,432,470 R403C probably benign Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Gatd1 G T 7: 141,408,948 probably benign Het
Gm10330 A T 12: 23,779,960 Y73* probably null Het
Gm21319 T A 12: 87,773,742 K16* probably null Het
Grn C A 11: 102,430,554 probably benign Het
Hdc C T 2: 126,604,300 E180K probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lamtor3 A T 3: 137,925,148 R27S probably damaging Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Morc1 A G 16: 48,502,336 D332G probably benign Het
Myo15 T C 11: 60,491,667 I1523T probably damaging Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nfix A G 8: 84,772,084 F87L possibly damaging Het
Nup155 C A 15: 8,124,238 T421K probably benign Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr209 A T 16: 59,361,704 N171K probably damaging Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Pds5a A C 5: 65,635,337 V751G probably benign Het
Podnl1 G T 8: 84,126,336 C45F probably damaging Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ptprk T A 10: 28,551,717 I764N probably damaging Het
Rbm33 A T 5: 28,342,411 Q193L probably benign Het
Rnasel C A 1: 153,753,931 H64Q probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Scamp3 A G 3: 89,180,909 probably benign Het
Sema6b C T 17: 56,132,497 probably null Het
Six4 A C 12: 73,103,626 I715R probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spdya A T 17: 71,562,504 Y98F possibly damaging Het
Tert T C 13: 73,646,309 probably null Het
Tex22 G A 12: 113,088,484 C54Y probably damaging Het
Tmem198b C T 10: 128,802,073 R207H probably damaging Het
Trbv13-1 C T 6: 41,116,255 Q42* probably null Het
Trcg1 T C 9: 57,242,279 L378P probably damaging Het
Trpv5 T G 6: 41,659,713 D433A probably damaging Het
Ube3b A G 5: 114,407,641 N654D probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vwa7 A T 17: 35,022,733 Y448F probably damaging Het
Zan A C 5: 137,383,837 D5149E unknown Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zhx1 G A 15: 58,054,142 T236I possibly damaging Het
Other mutations in Gsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Gsn APN 2 35284037 missense probably damaging 1.00
IGL02119:Gsn APN 2 35302495 missense probably damaging 1.00
IGL02512:Gsn APN 2 35283950 nonsense probably null
IGL02550:Gsn APN 2 35282607 intron probably benign
IGL02975:Gsn APN 2 35304654 missense probably benign 0.25
IGL03061:Gsn APN 2 35282459 intron probably benign
R0321:Gsn UTSW 2 35290396 missense probably benign 0.03
R0454:Gsn UTSW 2 35304639 missense probably damaging 1.00
R1446:Gsn UTSW 2 35306586 missense probably benign 0.04
R1760:Gsn UTSW 2 35284823 missense probably damaging 1.00
R1974:Gsn UTSW 2 35301471 missense probably damaging 1.00
R2258:Gsn UTSW 2 35290337 missense probably damaging 1.00
R2260:Gsn UTSW 2 35290337 missense probably damaging 1.00
R2281:Gsn UTSW 2 35283918 missense probably benign 0.01
R2495:Gsn UTSW 2 35303193 missense probably damaging 1.00
R2516:Gsn UTSW 2 35283953 missense probably benign
R3896:Gsn UTSW 2 35302638 missense possibly damaging 0.92
R4003:Gsn UTSW 2 35283983 missense probably benign 0.38
R4006:Gsn UTSW 2 35307621 nonsense probably null
R4281:Gsn UTSW 2 35298871 missense probably damaging 1.00
R4291:Gsn UTSW 2 35290420 missense probably benign 0.14
R4692:Gsn UTSW 2 35298871 missense probably damaging 1.00
R4850:Gsn UTSW 2 35283900 splice site probably null
R4895:Gsn UTSW 2 35302578 missense probably damaging 1.00
R5011:Gsn UTSW 2 35298921 missense probably damaging 1.00
R5290:Gsn UTSW 2 35296472 missense probably benign 0.01
R6472:Gsn UTSW 2 35290451 unclassified probably null
R6764:Gsn UTSW 2 35284044 missense probably damaging 1.00
R7018:Gsn UTSW 2 35293506 missense probably benign 0.03
R7036:Gsn UTSW 2 35292599 missense probably damaging 1.00
R7097:Gsn UTSW 2 35295049 nonsense probably null
R7122:Gsn UTSW 2 35295049 nonsense probably null
R7183:Gsn UTSW 2 35294948 missense probably benign 0.00
R7203:Gsn UTSW 2 35298795 missense probably benign 0.00
R7456:Gsn UTSW 2 35282706 missense possibly damaging 0.84
R7488:Gsn UTSW 2 35296421 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ACACTGTCCACTATACTGGGG -3'
(R):5'- TCCCTAAGTTGGGCATGACAAG -3'

Sequencing Primer
(F):5'- TTGCCCAGGGTGACAGAG -3'
(R):5'- CAAGAAGTTCAGGGTTGTGACTC -3'
Posted On2016-06-06