Incidental Mutation 'R5013:Aqp3'
ID390622
Institutional Source Beutler Lab
Gene Symbol Aqp3
Ensembl Gene ENSMUSG00000028435
Gene Nameaquaporin 3
SynonymsRP23-28I8.7, AQP-2, OTTMUSP00000006982, GIL, Gill blood group
MMRRC Submission 042604-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5013 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41092722-41098183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41093819 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 225 (F225L)
Ref Sequence ENSEMBL: ENSMUSP00000055110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055327]
Predicted Effect probably damaging
Transcript: ENSMUST00000055327
AA Change: F225L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055110
Gene: ENSMUSG00000028435
AA Change: F225L

DomainStartEndE-ValueType
Pfam:MIP 16 261 5.9e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154722
Meta Mutation Damage Score 0.2588 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the water channel protein aquaporin 3. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein, also known as aquaporin 0. Aquaporin 3 is localized at the basal lateral membranes of collecting duct cells in the kidney. In addition to its water channel function, aquaporin 3 has been found to facilitate the transport of nonionic small solutes such as urea and glycerol, but to a smaller degree. It has been suggested that water channels can be functionally heterogeneous and possess water and solute permeation mechanisms. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Animals homozygous for a mutation in this gene display increased drinking behavior, increased urination, and decreased urine osmolality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Abca12 A G 1: 71,264,767 L2117P probably damaging Het
Ago3 A T 4: 126,368,598 S386R probably benign Het
Agxt T C 1: 93,142,057 probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Anxa1 A G 19: 20,382,923 V108A probably benign Het
Atp11b T G 3: 35,834,383 I934R possibly damaging Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Bcr A G 10: 75,125,066 D443G probably benign Het
Cbfa2t3 G T 8: 122,638,859 D211E possibly damaging Het
Ccdc146 A T 5: 21,333,038 L96Q probably damaging Het
Cdh16 A G 8: 104,617,028 I612T probably damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajc2 G A 5: 21,757,773 R521* probably null Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fbxw17 C T 13: 50,432,470 R403C probably benign Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Gatd1 G T 7: 141,408,948 probably benign Het
Gm10330 A T 12: 23,779,960 Y73* probably null Het
Gm21319 T A 12: 87,773,742 K16* probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Hdc C T 2: 126,604,300 E180K probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lamtor3 A T 3: 137,925,148 R27S probably damaging Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Morc1 A G 16: 48,502,336 D332G probably benign Het
Myo15 T C 11: 60,491,667 I1523T probably damaging Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nfix A G 8: 84,772,084 F87L possibly damaging Het
Nup155 C A 15: 8,124,238 T421K probably benign Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr209 A T 16: 59,361,704 N171K probably damaging Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Pds5a A C 5: 65,635,337 V751G probably benign Het
Podnl1 G T 8: 84,126,336 C45F probably damaging Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ptprk T A 10: 28,551,717 I764N probably damaging Het
Rbm33 A T 5: 28,342,411 Q193L probably benign Het
Rnasel C A 1: 153,753,931 H64Q probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Scamp3 A G 3: 89,180,909 probably benign Het
Sema6b C T 17: 56,132,497 probably null Het
Six4 A C 12: 73,103,626 I715R probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spdya A T 17: 71,562,504 Y98F possibly damaging Het
Tert T C 13: 73,646,309 probably null Het
Tex22 G A 12: 113,088,484 C54Y probably damaging Het
Tmem198b C T 10: 128,802,073 R207H probably damaging Het
Trbv13-1 C T 6: 41,116,255 Q42* probably null Het
Trcg1 T C 9: 57,242,279 L378P probably damaging Het
Trpv5 T G 6: 41,659,713 D433A probably damaging Het
Ube3b A G 5: 114,407,641 N654D probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vwa7 A T 17: 35,022,733 Y448F probably damaging Het
Zan A C 5: 137,383,837 D5149E unknown Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zhx1 G A 15: 58,054,142 T236I possibly damaging Het
Other mutations in Aqp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Aqp3 APN 4 41093632 missense probably damaging 1.00
IGL02994:Aqp3 APN 4 41093614 missense probably benign 0.09
phoebus UTSW 4 41095252 missense probably benign 0.05
R0138:Aqp3 UTSW 4 41094843 splice site probably benign
R2097:Aqp3 UTSW 4 41098004 missense possibly damaging 0.95
R2128:Aqp3 UTSW 4 41098061 missense probably benign 0.00
R2129:Aqp3 UTSW 4 41098061 missense probably benign 0.00
R2278:Aqp3 UTSW 4 41093836 missense probably damaging 1.00
R7176:Aqp3 UTSW 4 41095202 missense probably damaging 1.00
R7365:Aqp3 UTSW 4 41098003 missense probably benign 0.14
R7385:Aqp3 UTSW 4 41095178 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTGGCAACCAATCATGAGCTG -3'
(R):5'- CTCTCCCAGTTCATAGGCAC -3'

Sequencing Primer
(F):5'- CCAATCATGAGCTGGTACACG -3'
(R):5'- ACAGCCGCCCTTATTGTGTG -3'
Posted On2016-06-06