Incidental Mutation 'R5013:Tert'
ID390664
Institutional Source Beutler Lab
Gene Symbol Tert
Ensembl Gene ENSMUSG00000021611
Gene Nametelomerase reverse transcriptase
SynonymsTR
MMRRC Submission 042604-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R5013 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73626911-73649843 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 73646309 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022104] [ENSMUST00000221522] [ENSMUST00000223303]
Predicted Effect probably null
Transcript: ENSMUST00000022104
SMART Domains Protein: ENSMUSP00000022104
Gene: ENSMUSG00000021611

DomainStartEndE-ValueType
Blast:Telomerase_RBD 329 375 2e-6 BLAST
Telomerase_RBD 449 584 5.02e-75 SMART
Blast:Telomerase_RBD 651 688 1e-5 BLAST
Pfam:RVT_1 787 918 6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221522
Predicted Effect probably benign
Transcript: ENSMUST00000222251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222912
Predicted Effect probably benign
Transcript: ENSMUST00000223303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223325
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of impaired telomerase function, homozygous mutant mice are overtly normal in early generations. Impaired fertility has been reported in later generations for homozygotes of at least one knockout allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Abca12 A G 1: 71,264,767 L2117P probably damaging Het
Ago3 A T 4: 126,368,598 S386R probably benign Het
Agxt T C 1: 93,142,057 probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Anxa1 A G 19: 20,382,923 V108A probably benign Het
Aqp3 A G 4: 41,093,819 F225L probably damaging Het
Atp11b T G 3: 35,834,383 I934R possibly damaging Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Bcr A G 10: 75,125,066 D443G probably benign Het
Cbfa2t3 G T 8: 122,638,859 D211E possibly damaging Het
Ccdc146 A T 5: 21,333,038 L96Q probably damaging Het
Cdh16 A G 8: 104,617,028 I612T probably damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajc2 G A 5: 21,757,773 R521* probably null Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fbxw17 C T 13: 50,432,470 R403C probably benign Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Gatd1 G T 7: 141,408,948 probably benign Het
Gm10330 A T 12: 23,779,960 Y73* probably null Het
Gm21319 T A 12: 87,773,742 K16* probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Hdc C T 2: 126,604,300 E180K probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lamtor3 A T 3: 137,925,148 R27S probably damaging Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Morc1 A G 16: 48,502,336 D332G probably benign Het
Myo15 T C 11: 60,491,667 I1523T probably damaging Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nfix A G 8: 84,772,084 F87L possibly damaging Het
Nup155 C A 15: 8,124,238 T421K probably benign Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr209 A T 16: 59,361,704 N171K probably damaging Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Pds5a A C 5: 65,635,337 V751G probably benign Het
Podnl1 G T 8: 84,126,336 C45F probably damaging Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ptprk T A 10: 28,551,717 I764N probably damaging Het
Rbm33 A T 5: 28,342,411 Q193L probably benign Het
Rnasel C A 1: 153,753,931 H64Q probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Scamp3 A G 3: 89,180,909 probably benign Het
Sema6b C T 17: 56,132,497 probably null Het
Six4 A C 12: 73,103,626 I715R probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spdya A T 17: 71,562,504 Y98F possibly damaging Het
Tex22 G A 12: 113,088,484 C54Y probably damaging Het
Tmem198b C T 10: 128,802,073 R207H probably damaging Het
Trbv13-1 C T 6: 41,116,255 Q42* probably null Het
Trcg1 T C 9: 57,242,279 L378P probably damaging Het
Trpv5 T G 6: 41,659,713 D433A probably damaging Het
Ube3b A G 5: 114,407,641 N654D probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vwa7 A T 17: 35,022,733 Y448F probably damaging Het
Zan A C 5: 137,383,837 D5149E unknown Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zhx1 G A 15: 58,054,142 T236I possibly damaging Het
Other mutations in Tert
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Tert APN 13 73628297 missense possibly damaging 0.76
IGL01585:Tert APN 13 73634344 missense probably benign 0.15
IGL03167:Tert APN 13 73640000 missense probably damaging 1.00
FR4304:Tert UTSW 13 73648302 utr 3 prime probably benign
FR4342:Tert UTSW 13 73648300 utr 3 prime probably benign
FR4589:Tert UTSW 13 73648304 utr 3 prime probably benign
PIT4377001:Tert UTSW 13 73628261 missense possibly damaging 0.54
R0372:Tert UTSW 13 73648991 missense probably damaging 1.00
R0433:Tert UTSW 13 73627081 missense probably damaging 1.00
R0829:Tert UTSW 13 73644385 missense probably damaging 1.00
R1023:Tert UTSW 13 73642059 missense probably benign 0.41
R1236:Tert UTSW 13 73636379 missense probably damaging 0.99
R1331:Tert UTSW 13 73648354 missense probably damaging 1.00
R1426:Tert UTSW 13 73642353 splice site probably benign
R1467:Tert UTSW 13 73628209 missense probably benign 0.10
R1467:Tert UTSW 13 73628209 missense probably benign 0.10
R1521:Tert UTSW 13 73642056 missense probably damaging 1.00
R2484:Tert UTSW 13 73647985 missense probably benign
R3162:Tert UTSW 13 73627409 missense possibly damaging 0.45
R3162:Tert UTSW 13 73627409 missense possibly damaging 0.45
R4428:Tert UTSW 13 73627475 missense probably damaging 1.00
R4430:Tert UTSW 13 73627475 missense probably damaging 1.00
R4431:Tert UTSW 13 73627475 missense probably damaging 1.00
R4630:Tert UTSW 13 73648991 missense probably damaging 1.00
R4696:Tert UTSW 13 73627820 missense probably benign 0.25
R4751:Tert UTSW 13 73628063 missense possibly damaging 0.89
R4926:Tert UTSW 13 73648389 missense possibly damaging 0.62
R5011:Tert UTSW 13 73646309 critical splice donor site probably null
R5061:Tert UTSW 13 73634278 missense probably damaging 1.00
R5268:Tert UTSW 13 73627354 missense probably damaging 1.00
R5323:Tert UTSW 13 73648371 missense probably benign 0.07
R5396:Tert UTSW 13 73639243 missense probably damaging 0.97
R5445:Tert UTSW 13 73644284 missense probably benign 0.00
R5680:Tert UTSW 13 73642351 splice site probably null
R5688:Tert UTSW 13 73639156 missense probably damaging 1.00
R6092:Tert UTSW 13 73628581 missense probably benign 0.34
R6973:Tert UTSW 13 73627988 missense probably benign 0.02
R7069:Tert UTSW 13 73628410 missense probably damaging 0.99
R7317:Tert UTSW 13 73642376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAAGCCTGCCTTGTGTG -3'
(R):5'- AGGGTGAATGCTCAGGGATC -3'

Sequencing Primer
(F):5'- CACTGATGTCGGTCTCTCAGGAG -3'
(R):5'- TGAATGCTCAGGGATCCTCAGTAC -3'
Posted On2016-06-06