Incidental Mutation 'R5013:Clcn2'
ID 390672
Institutional Source Beutler Lab
Gene Symbol Clcn2
Ensembl Gene ENSMUSG00000022843
Gene Name chloride channel, voltage-sensitive 2
Synonyms ClC-2, nmf240, Clc2
MMRRC Submission 042604-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock # R5013 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 20702964-20717746 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 20707215 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 785 (P785S)
Ref Sequence ENSEMBL: ENSMUSP00000112759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000056518] [ENSMUST00000118919] [ENSMUST00000120099] [ENSMUST00000131522] [ENSMUST00000232309]
AlphaFold Q9R0A1
Predicted Effect probably damaging
Transcript: ENSMUST00000007207
AA Change: P802S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843
AA Change: P802S

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 555 1.2e-94 PFAM
Blast:CBS 595 644 3e-12 BLAST
low complexity region 666 680 N/A INTRINSIC
CBS 803 850 3.69e0 SMART
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056518
SMART Domains Protein: ENSMUSP00000060194
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
low complexity region 45 60 N/A INTRINSIC
Pfam:FAM131 80 356 6.4e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118919
SMART Domains Protein: ENSMUSP00000113719
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
Pfam:FAM131 1 271 4e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120099
AA Change: P785S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843
AA Change: P785S

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 538 5.6e-77 PFAM
Blast:CBS 578 627 4e-12 BLAST
low complexity region 649 663 N/A INTRINSIC
CBS 786 833 3.69e0 SMART
low complexity region 852 864 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123417
Predicted Effect probably benign
Transcript: ENSMUST00000131522
SMART Domains Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 473 4.2e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153075
Predicted Effect probably benign
Transcript: ENSMUST00000231381
Predicted Effect probably damaging
Transcript: ENSMUST00000232309
AA Change: P758S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3258 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Abca12 A G 1: 71,264,767 L2117P probably damaging Het
Ago3 A T 4: 126,368,598 S386R probably benign Het
Agxt T C 1: 93,142,057 probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Anxa1 A G 19: 20,382,923 V108A probably benign Het
Aqp3 A G 4: 41,093,819 F225L probably damaging Het
Atp11b T G 3: 35,834,383 I934R possibly damaging Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Bcr A G 10: 75,125,066 D443G probably benign Het
Cbfa2t3 G T 8: 122,638,859 D211E possibly damaging Het
Ccdc146 A T 5: 21,333,038 L96Q probably damaging Het
Cdh16 A G 8: 104,617,028 I612T probably damaging Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajc2 G A 5: 21,757,773 R521* probably null Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fbxw17 C T 13: 50,432,470 R403C probably benign Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Gatd1 G T 7: 141,408,948 probably benign Het
Gm10330 A T 12: 23,779,960 Y73* probably null Het
Gm21319 T A 12: 87,773,742 K16* probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Hdc C T 2: 126,604,300 E180K probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lamtor3 A T 3: 137,925,148 R27S probably damaging Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Morc1 A G 16: 48,502,336 D332G probably benign Het
Myo15 T C 11: 60,491,667 I1523T probably damaging Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nfix A G 8: 84,772,084 F87L possibly damaging Het
Nup155 C A 15: 8,124,238 T421K probably benign Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr209 A T 16: 59,361,704 N171K probably damaging Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Pds5a A C 5: 65,635,337 V751G probably benign Het
Podnl1 G T 8: 84,126,336 C45F probably damaging Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ptprk T A 10: 28,551,717 I764N probably damaging Het
Rbm33 A T 5: 28,342,411 Q193L probably benign Het
Rnasel C A 1: 153,753,931 H64Q probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Scamp3 A G 3: 89,180,909 probably benign Het
Sema6b C T 17: 56,132,497 probably null Het
Six4 A C 12: 73,103,626 I715R probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spdya A T 17: 71,562,504 Y98F possibly damaging Het
Tert T C 13: 73,646,309 probably null Het
Tex22 G A 12: 113,088,484 C54Y probably damaging Het
Tmem198b C T 10: 128,802,073 R207H probably damaging Het
Trbv13-1 C T 6: 41,116,255 Q42* probably null Het
Trcg1 T C 9: 57,242,279 L378P probably damaging Het
Trpv5 T G 6: 41,659,713 D433A probably damaging Het
Ube3b A G 5: 114,407,641 N654D probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vwa7 A T 17: 35,022,733 Y448F probably damaging Het
Zan A C 5: 137,383,837 D5149E unknown Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zhx1 G A 15: 58,054,142 T236I possibly damaging Het
Other mutations in Clcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Clcn2 APN 16 20703641 missense probably benign 0.08
IGL01657:Clcn2 APN 16 20713619 missense probably damaging 1.00
IGL01797:Clcn2 APN 16 20712761 missense probably damaging 1.00
IGL02557:Clcn2 APN 16 20708464 missense probably damaging 1.00
IGL02624:Clcn2 APN 16 20703348 missense probably damaging 0.98
IGL02819:Clcn2 APN 16 20709256 nonsense probably null
IGL03329:Clcn2 APN 16 20712152 missense probably damaging 1.00
Bemr14 UTSW 16 unclassified
R0008:Clcn2 UTSW 16 20710390 missense probably null 1.00
R0454:Clcn2 UTSW 16 20710428 critical splice acceptor site probably null
R1101:Clcn2 UTSW 16 20703595 missense probably damaging 1.00
R1466:Clcn2 UTSW 16 20712552 splice site probably benign
R1824:Clcn2 UTSW 16 20715962 missense probably benign 0.04
R4592:Clcn2 UTSW 16 20709142 missense probably damaging 0.99
R5011:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5154:Clcn2 UTSW 16 20703303 missense probably benign 0.01
R5374:Clcn2 UTSW 16 20709669 missense possibly damaging 0.78
R5726:Clcn2 UTSW 16 20710535 intron probably benign
R5787:Clcn2 UTSW 16 20703433 missense probably damaging 1.00
R5992:Clcn2 UTSW 16 20713654 missense possibly damaging 0.68
R6045:Clcn2 UTSW 16 20711688 critical splice donor site probably null
R6663:Clcn2 UTSW 16 20703245 makesense probably null
R6765:Clcn2 UTSW 16 20707668 splice site probably null
R6825:Clcn2 UTSW 16 20709658 utr 3 prime probably benign
R7872:Clcn2 UTSW 16 20708460 missense probably damaging 0.99
R8028:Clcn2 UTSW 16 20708762 missense possibly damaging 0.66
R8198:Clcn2 UTSW 16 20707196 missense probably damaging 0.99
R8805:Clcn2 UTSW 16 20713418 missense probably damaging 1.00
R8924:Clcn2 UTSW 16 20712180 missense probably damaging 1.00
R8992:Clcn2 UTSW 16 20712330 missense probably damaging 1.00
R9074:Clcn2 UTSW 16 20712664 missense possibly damaging 0.78
R9101:Clcn2 UTSW 16 20707229 missense probably benign 0.00
R9456:Clcn2 UTSW 16 20715952 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTTACAGACTTACATGGC -3'
(R):5'- TCCCTCCTAGAGTGACTCAGAC -3'

Sequencing Primer
(F):5'- GCTTACAGACTTACATGGCTGAAAGC -3'
(R):5'- ATGCCATTAGACTCTAGAGGGTTTC -3'
Posted On 2016-06-06