Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Gpr45'

390679

Institutional Source

Beutler Lab

Gene Symbol

Gpr45

Ensembl Gene

ENSMUSG00000041907

Gene Name

G protein-coupled receptor 45

Synonyms

PSP24alpha, 9230112G11Rik

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42952872-43035456 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43032649 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 151 (I151V)

Ref Sequence

ENSEMBL: ENSMUSP00000135986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114761] [ENSMUST00000179766]

AlphaFold

Q9EQQ4

Predicted Effect

probably benign
Transcript: ENSMUST00000114761
AA Change: I151V

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000110409
Gene: ENSMUSG00000041907
AA Change: I151V

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	42	188	5.5e-9	PFAM
Pfam:7TM_GPCR_Srsx	45	340	1.9e-7	PFAM
Pfam:7tm_1	51	325	2.4e-52	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158463

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000179655

SMART Domains

Protein: ENSMUSP00000136725
Gene: ENSMUSG00000096364

Domain	Start	End	E-Value	Type
low complexity region	90	102	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179766
AA Change: I151V

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000135986
Gene: ENSMUSG00000041907
AA Change: I151V

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	42	189	7.1e-9	PFAM
Pfam:7TM_GPCR_Srsx	45	340	1.9e-7	PFAM
Pfam:7tm_1	51	325	2.1e-51	PFAM

Meta Mutation Damage Score

0.1941

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the G protein-coupled receptor (GPCR) family. Members of this protein family contain seven putative transmembrane domains and may mediate signaling processes to the interior of the cell via activation of heterotrimeric G proteins. This protein may function in the central nervous system. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Atad5	T	A	11: 80,094,676	S196R	probably benign	Het
Bcam	T	A	7: 19,756,860		probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dock3	T	C	9: 106,937,906	Y1254C	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Nostrin	A	T	2: 69,175,713	Q247L	possibly damaging	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pam	C	A	1: 97,821,917	D839Y	probably damaging	Het
Pds5a	A	G	5: 65,637,814	V693A	probably damaging	Het
Pigo	A	T	4: 43,021,337	L535Q	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rad51c	T	C	11: 87,397,754	H201R	probably benign	Het
Rims2	A	T	15: 39,517,869		probably null	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Serpini2	T	A	3: 75,259,477	T158S	probably damaging	Het
Slc12a3	A	G	8: 94,346,351	R701G	probably damaging	Het
Slc1a6	A	G	10: 78,814,602	E558G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tbr1	A	T	2: 61,806,002	I241F	possibly damaging	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Gpr45

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Gpr45	APN	1	43032292	missense	possibly damaging	0.77
IGL01528:Gpr45	APN	1	43033223	missense	probably benign	0.00
IGL01833:Gpr45	APN	1	43032242	missense	probably benign
IGL02034:Gpr45	APN	1	43033318	makesense	probably null
IGL02230:Gpr45	APN	1	43032656	missense	probably damaging	1.00
IGL02279:Gpr45	APN	1	43032838	missense	probably damaging	0.96
IGL02394:Gpr45	APN	1	43030112	intron	probably benign
IGL02795:Gpr45	APN	1	43032493	missense	possibly damaging	0.82
IGL02902:Gpr45	APN	1	43033211	missense	possibly damaging	0.67
IGL03017:Gpr45	APN	1	43032356	missense	possibly damaging	0.95
expansive	UTSW	1	43032838	missense	probably damaging	0.96
extensive	UTSW	1	43033058	missense	probably damaging	1.00
omnipresent	UTSW	1	43032374	missense	probably damaging	1.00
R0368:Gpr45	UTSW	1	43033016	missense	probably damaging	1.00
R2964:Gpr45	UTSW	1	43032508	missense	possibly damaging	0.87
R2965:Gpr45	UTSW	1	43032508	missense	possibly damaging	0.87
R2966:Gpr45	UTSW	1	43032508	missense	possibly damaging	0.87
R4551:Gpr45	UTSW	1	43032790	missense	probably benign	0.00
R4681:Gpr45	UTSW	1	43032908	missense	probably benign	0.00
R4821:Gpr45	UTSW	1	43030453	intron	probably benign
R4966:Gpr45	UTSW	1	43033120	missense	probably benign	0.00
R5319:Gpr45	UTSW	1	43032838	missense	probably damaging	0.96
R5667:Gpr45	UTSW	1	43033058	missense	probably damaging	1.00
R5671:Gpr45	UTSW	1	43033058	missense	probably damaging	1.00
R7250:Gpr45	UTSW	1	43032371	missense	probably damaging	1.00
R8117:Gpr45	UTSW	1	43033315	missense	probably damaging	1.00
R8393:Gpr45	UTSW	1	43032235	missense	probably benign	0.00
R8752:Gpr45	UTSW	1	43032682	missense	possibly damaging	0.94
R8927:Gpr45	UTSW	1	43033154	missense	probably damaging	0.98
R8928:Gpr45	UTSW	1	43033154	missense	probably damaging	0.98
R9316:Gpr45	UTSW	1	43032374	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCTGTCTTTATGCTGCATGC -3'
(R):5'- TAGGAGCACAACATGACGCC -3'

Sequencing Primer
(F):5'- ATGCTGCATGCCATTCACGG -3'
(R):5'- CGAAGGGAGCAAAGAACACTGC -3'

Posted On

2016-06-06