Incidental Mutation 'R5054:Gmppa'
ID 390681
Institutional Source Beutler Lab
Gene Symbol Gmppa
Ensembl Gene ENSMUSG00000033021
Gene Name GDP-mannose pyrophosphorylase A
Synonyms 1810012N01Rik
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.452) question?
Stock # R5054 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 75412574-75419823 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 75416015 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 137 (Y137*)
Ref Sequence ENSEMBL: ENSMUSP00000139936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037796] [ENSMUST00000113584] [ENSMUST00000131545] [ENSMUST00000133418] [ENSMUST00000140287] [ENSMUST00000141124] [ENSMUST00000188097] [ENSMUST00000143730] [ENSMUST00000144874] [ENSMUST00000145166]
AlphaFold Q922H4
Predicted Effect probably null
Transcript: ENSMUST00000037796
AA Change: Y152*
SMART Domains Protein: ENSMUSP00000035564
Gene: ENSMUSG00000033021
AA Change: Y152*

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 1.2e-30 PFAM
Pfam:NTP_transf_3 4 206 4.1e-10 PFAM
Pfam:Hexapep 280 321 2.6e-8 PFAM
low complexity region 357 365 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113584
AA Change: Y152*
SMART Domains Protein: ENSMUSP00000109214
Gene: ENSMUSG00000033021
AA Change: Y152*

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 1.6e-28 PFAM
Pfam:NTP_transf_3 4 206 1.6e-9 PFAM
Pfam:Hexapep 286 321 4.3e-8 PFAM
low complexity region 357 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124539
Predicted Effect probably null
Transcript: ENSMUST00000131545
AA Change: Y152*
SMART Domains Protein: ENSMUSP00000120841
Gene: ENSMUSG00000033021
AA Change: Y152*

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 7.2e-31 PFAM
Pfam:NTP_transf_3 4 157 1.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132291
Predicted Effect probably null
Transcript: ENSMUST00000133418
AA Change: Y152*
SMART Domains Protein: ENSMUSP00000122443
Gene: ENSMUSG00000033021
AA Change: Y152*

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 6.8e-31 PFAM
Pfam:NTP_transf_3 4 204 1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135453
Predicted Effect probably null
Transcript: ENSMUST00000140287
AA Change: Y152*
SMART Domains Protein: ENSMUSP00000121552
Gene: ENSMUSG00000033021
AA Change: Y152*

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 161 1.7e-22 PFAM
Pfam:NTP_transf_3 4 155 6.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141124
SMART Domains Protein: ENSMUSP00000116783
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 72 1.1e-13 PFAM
Pfam:NTP_transf_3 4 71 1.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000188097
AA Change: Y137*
SMART Domains Protein: ENSMUSP00000139936
Gene: ENSMUSG00000033021
AA Change: Y137*

DomainStartEndE-ValueType
Pfam:NTP_transferase 1 150 2.3e-15 PFAM
Pfam:NTP_transf_3 2 142 9.8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143730
AA Change: Y152*
SMART Domains Protein: ENSMUSP00000114375
Gene: ENSMUSG00000033021
AA Change: Y152*

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 196 1.1e-30 PFAM
Pfam:NTP_transf_3 4 173 9.2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144874
AA Change: Y117*
SMART Domains Protein: ENSMUSP00000121418
Gene: ENSMUSG00000033021
AA Change: Y117*

DomainStartEndE-ValueType
Pfam:NTP_transferase 1 174 6.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145166
SMART Domains Protein: ENSMUSP00000116754
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 91 5.2e-15 PFAM
Pfam:NTP_transf_3 4 88 1.4e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to encode a GDP-mannose pyrophosphorylase. This enzyme catalyzes the reaction which converts mannose-1-phosphate and GTP to GDP-mannose which is involved in the production of N-linked oligosaccharides. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,837,315 (GRCm39) Y257H probably damaging Het
Adam28 C T 14: 68,855,164 (GRCm39) C659Y probably damaging Het
Adamtsl2 G A 2: 26,991,732 (GRCm39) E627K probably damaging Het
Atad5 T A 11: 79,985,502 (GRCm39) S196R probably benign Het
Bcam T A 7: 19,490,785 (GRCm39) probably benign Het
Birc6 A G 17: 74,962,320 (GRCm39) H3978R probably damaging Het
Btbd7 T C 12: 102,804,471 (GRCm39) I190V probably benign Het
Ccdc8 T C 7: 16,728,970 (GRCm39) V153A probably damaging Het
Cyp2a5 C G 7: 26,540,529 (GRCm39) R68G probably damaging Het
Dock3 T C 9: 106,815,105 (GRCm39) Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 (GRCm39) E2794G possibly damaging Het
Dytn C A 1: 63,700,318 (GRCm39) V271L possibly damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif2s2 A C 2: 154,734,590 (GRCm39) probably null Het
Fndc7 A G 3: 108,788,663 (GRCm39) S193P probably damaging Het
Fzr1 G A 10: 81,207,253 (GRCm39) probably benign Het
Gm17472 T C 6: 42,957,938 (GRCm39) I69T probably damaging Het
Gpr45 A G 1: 43,071,809 (GRCm39) I151V probably benign Het
H1f0 G A 15: 78,912,973 (GRCm39) A18T probably damaging Het
Hbb-bh1 C T 7: 103,491,063 (GRCm39) V114I probably benign Het
Impa2 C A 18: 67,439,797 (GRCm39) P98Q probably damaging Het
Kazn T C 4: 141,835,957 (GRCm39) N573D unknown Het
Kcna2 A T 3: 107,011,656 (GRCm39) D79V probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kif13a A G 13: 46,956,122 (GRCm39) Y561H probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klra1 T A 6: 130,352,247 (GRCm39) Q165L probably damaging Het
Mat2b T A 11: 40,570,869 (GRCm39) R318S probably damaging Het
Mgat4d G A 8: 84,094,837 (GRCm39) probably null Het
Mtor T A 4: 148,641,312 (GRCm39) probably null Het
Nostrin A T 2: 69,006,057 (GRCm39) Q247L possibly damaging Het
Obi1 C T 14: 104,745,466 (GRCm39) G70E probably damaging Het
Obscn T C 11: 58,964,443 (GRCm39) E3033G probably damaging Het
Pam C A 1: 97,749,642 (GRCm39) D839Y probably damaging Het
Pds5a A G 5: 65,795,157 (GRCm39) V693A probably damaging Het
Pigo A T 4: 43,021,337 (GRCm39) L535Q probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Ptar1 G T 19: 23,671,729 (GRCm39) R44L probably damaging Het
Rad51c T C 11: 87,288,580 (GRCm39) H201R probably benign Het
Rims2 A T 15: 39,381,265 (GRCm39) probably null Het
Rpl22l1 T G 3: 28,860,985 (GRCm39) S67A possibly damaging Het
Rps10 A G 17: 27,849,454 (GRCm39) S143P probably damaging Het
Rundc1 T C 11: 101,315,967 (GRCm39) V13A probably benign Het
Sephs2 C A 7: 126,872,564 (GRCm39) M176I probably benign Het
Serpina16 C T 12: 103,641,189 (GRCm39) V179I probably benign Het
Serpini2 T A 3: 75,166,784 (GRCm39) T158S probably damaging Het
Slc12a3 A G 8: 95,072,979 (GRCm39) R701G probably damaging Het
Slc1a6 A G 10: 78,650,436 (GRCm39) E558G probably damaging Het
Ssx2ip T C 3: 146,136,672 (GRCm39) probably benign Het
Tbr1 A T 2: 61,636,346 (GRCm39) I241F possibly damaging Het
Tgfa G C 6: 86,247,064 (GRCm39) probably null Het
Tlr12 T A 4: 128,511,063 (GRCm39) K396* probably null Het
Tmppe A G 9: 114,235,026 (GRCm39) I442V probably benign Het
Tubb3 T C 8: 124,147,607 (GRCm39) V180A probably damaging Het
Vmn1r222 A G 13: 23,416,901 (GRCm39) V104A probably damaging Het
Vmn2r95 G T 17: 18,671,708 (GRCm39) V482L possibly damaging Het
Zfp184 G T 13: 22,143,452 (GRCm39) R386L possibly damaging Het
Zfp444 T A 7: 6,192,792 (GRCm39) V270E probably damaging Het
Zfp985 A T 4: 147,667,438 (GRCm39) Y102F probably damaging Het
Other mutations in Gmppa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01871:Gmppa APN 1 75,413,661 (GRCm39) missense probably damaging 0.98
IGL02418:Gmppa APN 1 75,415,664 (GRCm39) missense probably damaging 1.00
IGL02899:Gmppa APN 1 75,418,474 (GRCm39) splice site probably null
IGL03009:Gmppa APN 1 75,416,014 (GRCm39) missense probably damaging 1.00
PIT4151001:Gmppa UTSW 1 75,418,468 (GRCm39) nonsense probably null
R0708:Gmppa UTSW 1 75,419,218 (GRCm39) missense probably damaging 1.00
R1352:Gmppa UTSW 1 75,417,178 (GRCm39) missense probably benign 0.00
R1886:Gmppa UTSW 1 75,419,152 (GRCm39) missense probably damaging 1.00
R2000:Gmppa UTSW 1 75,418,172 (GRCm39) missense probably damaging 1.00
R3053:Gmppa UTSW 1 75,418,400 (GRCm39) missense probably benign 0.04
R4301:Gmppa UTSW 1 75,419,140 (GRCm39) missense possibly damaging 0.77
R5791:Gmppa UTSW 1 75,418,899 (GRCm39) missense possibly damaging 0.58
R6801:Gmppa UTSW 1 75,418,391 (GRCm39) missense possibly damaging 0.94
R7806:Gmppa UTSW 1 75,415,581 (GRCm39) missense probably damaging 1.00
R8105:Gmppa UTSW 1 75,413,641 (GRCm39) missense possibly damaging 0.82
R8747:Gmppa UTSW 1 75,416,025 (GRCm39) missense probably damaging 0.97
R8878:Gmppa UTSW 1 75,414,932 (GRCm39) missense probably damaging 1.00
R9491:Gmppa UTSW 1 75,415,602 (GRCm39) missense probably damaging 0.98
R9541:Gmppa UTSW 1 75,417,094 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCCTGAGCCCTTTGGTTG -3'
(R):5'- CACTCCTACAGAAACGAGCTGG -3'

Sequencing Primer
(F):5'- AGCCCTTTGGTTGCTGGAAAG -3'
(R):5'- GAAACGAGCTGGCGCCC -3'
Posted On 2016-06-06