Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Pam'

390682

Institutional Source

Beutler Lab

Gene Symbol

Pam

Ensembl Gene

ENSMUSG00000026335

Gene Name

peptidylglycine alpha-amidating monooxygenase

Synonyms

PHM

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

97795114-98095646 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 97821917 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 839 (D839Y)

Ref Sequence

ENSEMBL: ENSMUSP00000125418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058762] [ENSMUST00000097625] [ENSMUST00000161567]

AlphaFold

P97467

Predicted Effect

probably damaging
Transcript: ENSMUST00000058762
AA Change: D945Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057112
Gene: ENSMUSG00000026335
AA Change: D945Y

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Cu2_monooxygen	62	178	7.8e-27	PFAM
Pfam:Cu2_monoox_C	199	346	6.2e-47	PFAM
Pfam:NHL	633	662	2.1e-8	PFAM
low complexity region	673	680	N/A	INTRINSIC
Pfam:NHL	686	714	2.7e-8	PFAM
Pfam:NHL	782	809	2.8e-7	PFAM
transmembrane domain	870	892	N/A	INTRINSIC
low complexity region	908	930	N/A	INTRINSIC
low complexity region	950	969	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000097625
AA Change: D944Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095228
Gene: ENSMUSG00000026335
AA Change: D944Y

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Cu2_monooxygen	60	183	3.7e-34	PFAM
Pfam:Cu2_monoox_C	198	349	1.4e-54	PFAM
Pfam:NHL	581	608	9.4e-9	PFAM
Pfam:NHL	633	662	2.1e-8	PFAM
low complexity region	673	680	N/A	INTRINSIC
Pfam:NHL	686	714	2.2e-8	PFAM
Pfam:NHL	782	809	3.6e-8	PFAM
transmembrane domain	869	891	N/A	INTRINSIC
low complexity region	907	929	N/A	INTRINSIC
low complexity region	949	968	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159041

SMART Domains

Protein: ENSMUSP00000124284
Gene: ENSMUSG00000026335

Domain	Start	End	E-Value	Type
low complexity region	37	44	N/A	INTRINSIC
Pfam:NHL	50	78	4.2e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159585

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160210

Predicted Effect

probably damaging
Transcript: ENSMUST00000161567
AA Change: D839Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125418
Gene: ENSMUSG00000026335
AA Change: D839Y

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Cu2_monooxygen	60	183	3.2e-34	PFAM
Pfam:Cu2_monoox_C	198	349	1.2e-54	PFAM
Pfam:NHL	475	502	8.3e-9	PFAM
Pfam:NHL	527	556	1.9e-8	PFAM
low complexity region	567	574	N/A	INTRINSIC
Pfam:NHL	580	608	1.9e-8	PFAM
Pfam:NHL	676	703	3.2e-8	PFAM
transmembrane domain	764	786	N/A	INTRINSIC
low complexity region	802	824	N/A	INTRINSIC
low complexity region	844	863	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000162681
AA Change: D154Y

SMART Domains

Protein: ENSMUSP00000125133
Gene: ENSMUSG00000026335
AA Change: D154Y

Domain	Start	End	E-Value	Type
Pfam:NHL	78	105	6.2e-8	PFAM
low complexity region	160	179	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162803

Meta Mutation Damage Score

0.4095

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme includes two domains with distinct catalytic activities, a peptidylglycine alpha-hydroxylating monooxygenase (PHM) domain and a peptidyl-alpha-hydroxyglycine alpha-amidating lyase (PAL) domain. These catalytic domains work sequentially to catalyze the conversion of neuroendocrine peptides to active alpha-amidated products. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during fetal growth and development, edema, abnormal yolk sac vasculature, thin arterial walls, and abnormal bronchial epithelial morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Atad5	T	A	11: 80,094,676	S196R	probably benign	Het
Bcam	T	A	7: 19,756,860		probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dock3	T	C	9: 106,937,906	Y1254C	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
Gpr45	A	G	1: 43,032,649	I151V	probably benign	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Nostrin	A	T	2: 69,175,713	Q247L	possibly damaging	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pds5a	A	G	5: 65,637,814	V693A	probably damaging	Het
Pigo	A	T	4: 43,021,337	L535Q	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rad51c	T	C	11: 87,397,754	H201R	probably benign	Het
Rims2	A	T	15: 39,517,869		probably null	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Serpini2	T	A	3: 75,259,477	T158S	probably damaging	Het
Slc12a3	A	G	8: 94,346,351	R701G	probably damaging	Het
Slc1a6	A	G	10: 78,814,602	E558G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tbr1	A	T	2: 61,806,002	I241F	possibly damaging	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Pam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Pam	APN	1	97924427	splice site	probably benign
IGL00485:Pam	APN	1	97822953	missense	possibly damaging	0.78
IGL00597:Pam	APN	1	97834444	missense	probably benign	0.02
IGL01585:Pam	APN	1	97864472	missense	probably damaging	0.99
IGL01776:Pam	APN	1	97885600	critical splice donor site	probably null
IGL01981:Pam	APN	1	97834441	missense	probably damaging	1.00
IGL02152:Pam	APN	1	97840749	missense	probably damaging	1.00
IGL02605:Pam	APN	1	97840339	missense	possibly damaging	0.85
IGL02882:Pam	APN	1	97840367	missense	probably damaging	1.00
IGL03142:Pam	APN	1	97894386	missense	probably damaging	1.00
IGL03409:Pam	APN	1	97864329	missense	probably benign	0.04
R0084:Pam	UTSW	1	97896049	missense	probably benign	0.01
R0200:Pam	UTSW	1	97894401	splice site	probably null
R0520:Pam	UTSW	1	97884195	missense	probably benign	0.00
R0734:Pam	UTSW	1	97864362	nonsense	probably null
R1881:Pam	UTSW	1	97923151	missense	probably benign	0.06
R2040:Pam	UTSW	1	97864442	missense	possibly damaging	0.55
R2106:Pam	UTSW	1	97831490	missense	probably damaging	1.00
R2913:Pam	UTSW	1	97923129	missense	probably damaging	1.00
R3148:Pam	UTSW	1	97895678	missense	possibly damaging	0.84
R3618:Pam	UTSW	1	97834432	missense	probably damaging	1.00
R3619:Pam	UTSW	1	97834432	missense	probably damaging	1.00
R3847:Pam	UTSW	1	97854756	intron	probably benign
R3848:Pam	UTSW	1	97854756	intron	probably benign
R3849:Pam	UTSW	1	97854756	intron	probably benign
R4128:Pam	UTSW	1	97834468	missense	probably damaging	0.99
R4231:Pam	UTSW	1	97884124	critical splice donor site	probably null
R4233:Pam	UTSW	1	97864394	missense	possibly damaging	0.86
R4404:Pam	UTSW	1	97854721	intron	probably benign
R4536:Pam	UTSW	1	97844699	nonsense	probably null
R4738:Pam	UTSW	1	97923132	missense	probably damaging	1.00
R5501:Pam	UTSW	1	97840365	nonsense	probably null
R5572:Pam	UTSW	1	97854744	intron	probably benign
R5654:Pam	UTSW	1	97864398	missense	probably benign	0.00
R5659:Pam	UTSW	1	97842299	missense	probably damaging	1.00
R6112:Pam	UTSW	1	97834468	missense	probably damaging	0.99
R6513:Pam	UTSW	1	97838027	missense	possibly damaging	0.60
R6696:Pam	UTSW	1	97885727	missense	possibly damaging	0.79
R6743:Pam	UTSW	1	97896049	missense	probably benign	0.01
R6833:Pam	UTSW	1	97837992	missense	probably damaging	0.99
R6834:Pam	UTSW	1	97837992	missense	probably damaging	0.99
R7098:Pam	UTSW	1	97898347	missense	probably benign
R7117:Pam	UTSW	1	97977116	start gained	probably benign
R7152:Pam	UTSW	1	97885740	missense	probably damaging	1.00
R7172:Pam	UTSW	1	97834478	missense	probably benign	0.10
R7206:Pam	UTSW	1	97896032	missense	probably damaging	1.00
R7262:Pam	UTSW	1	97854723	missense
R7434:Pam	UTSW	1	97975790	nonsense	probably null
R7466:Pam	UTSW	1	97842247	missense	probably damaging	1.00
R7513:Pam	UTSW	1	97853185	missense	possibly damaging	0.88
R7790:Pam	UTSW	1	97821847	missense	probably damaging	1.00
R8054:Pam	UTSW	1	97840389	missense	probably damaging	1.00
R8093:Pam	UTSW	1	97885632	missense	probably damaging	1.00
R8183:Pam	UTSW	1	97834474	missense	probably benign	0.08
R8404:Pam	UTSW	1	97895633	missense	probably damaging	1.00
R8734:Pam	UTSW	1	97834402	splice site	probably benign
R9092:Pam	UTSW	1	97864251	missense	probably benign	0.00
R9229:Pam	UTSW	1	97825935	missense	probably benign	0.02
R9261:Pam	UTSW	1	97975895	missense	probably benign	0.00
R9409:Pam	UTSW	1	97821860	missense	probably damaging	1.00
R9435:Pam	UTSW	1	97894419	missense	probably benign	0.00
R9476:Pam	UTSW	1	97898340	critical splice donor site	probably null
R9500:Pam	UTSW	1	97844600	missense	probably benign	0.01
R9510:Pam	UTSW	1	97898340	critical splice donor site	probably null
R9653:Pam	UTSW	1	97840744	missense	possibly damaging	0.60
Z1176:Pam	UTSW	1	97934723	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATGCACAGAACTTTACACGCG -3'
(R):5'- TCTGGTTCTGTAAGGGAAATCTC -3'

Sequencing Primer
(F):5'- CAGAACTTTACACGCGTTAAAGG -3'
(R):5'- CTACTGTGGCATTCGATC -3'

Posted On

2016-06-06