Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Tbr1'

390685

Institutional Source

Beutler Lab

Gene Symbol

Tbr1

Ensembl Gene

ENSMUSG00000035033

Gene Name

T-box brain gene 1

Synonyms

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61802930-61814114 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 61806002 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 241 (I241F)

Ref Sequence

ENSEMBL: ENSMUSP00000046787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048934] [ENSMUST00000102737]

AlphaFold

Q64336

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048934
AA Change: I241F

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000046787
Gene: ENSMUSG00000035033
AA Change: I241F

Domain	Start	End	E-Value	Type
low complexity region	108	122	N/A	INTRINSIC
TBOX	203	398	1.6e-125	SMART
Pfam:T-box_assoc	418	679	9.6e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102737

SMART Domains

Protein: ENSMUSP00000099798
Gene: ENSMUSG00000035033

Domain	Start	End	E-Value	Type
TBOX	1	135	5.05e-41	SMART
low complexity region	184	193	N/A	INTRINSIC
low complexity region	306	315	N/A	INTRINSIC
low complexity region	319	329	N/A	INTRINSIC
low complexity region	355	365	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131538

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136867

Meta Mutation Damage Score

0.3168

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of numerous developmental processes. In mouse, the ortholog of this gene is expressed in the cerebral cortex, hippocampus, amygdala and olfactory bulb and is thought to play an important role in neuronal migration and axonal projection. In mouse, the C-terminal region of this protein was found to be necessary and sufficient for association with the guanylate kinase domain of calcium/calmodulin-dependent serine protein kinase. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted null allele fail to feed and die on the second postnatal day displaying disrupted forebrain morphology and a hypoplastic olfactory bulb that lacks normal mitral and tufted cells and shows a striking reduction in mature olfactory bulb projection neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Atad5	T	A	11: 80,094,676	S196R	probably benign	Het
Bcam	T	A	7: 19,756,860		probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dock3	T	C	9: 106,937,906	Y1254C	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
Gpr45	A	G	1: 43,032,649	I151V	probably benign	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Nostrin	A	T	2: 69,175,713	Q247L	possibly damaging	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pam	C	A	1: 97,821,917	D839Y	probably damaging	Het
Pds5a	A	G	5: 65,637,814	V693A	probably damaging	Het
Pigo	A	T	4: 43,021,337	L535Q	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rad51c	T	C	11: 87,397,754	H201R	probably benign	Het
Rims2	A	T	15: 39,517,869		probably null	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Serpini2	T	A	3: 75,259,477	T158S	probably damaging	Het
Slc12a3	A	G	8: 94,346,351	R701G	probably damaging	Het
Slc1a6	A	G	10: 78,814,602	E558G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Tbr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Tbr1	APN	2	61805281	missense	probably benign	0.14
IGL01309:Tbr1	APN	2	61806067	missense	possibly damaging	0.92
IGL02161:Tbr1	APN	2	61805239	nonsense	probably null
IGL02256:Tbr1	APN	2	61804874	missense	probably damaging	0.99
IGL02336:Tbr1	APN	2	61804992	missense	possibly damaging	0.93
IGL02526:Tbr1	APN	2	61811698	missense	probably benign	0.00
FR4340:Tbr1	UTSW	2	61806347	intron	probably benign
R0594:Tbr1	UTSW	2	61811620	missense	possibly damaging	0.49
R0847:Tbr1	UTSW	2	61805029	missense	probably benign	0.00
R1101:Tbr1	UTSW	2	61804739	missense	probably benign	0.00
R1247:Tbr1	UTSW	2	61811618	missense	possibly damaging	0.78
R1944:Tbr1	UTSW	2	61812256	missense	probably damaging	1.00
R3080:Tbr1	UTSW	2	61807291	nonsense	probably null
R4110:Tbr1	UTSW	2	61811732	missense	probably benign	0.18
R4111:Tbr1	UTSW	2	61811732	missense	probably benign	0.18
R4440:Tbr1	UTSW	2	61804838	missense	possibly damaging	0.92
R4790:Tbr1	UTSW	2	61811588	missense	probably benign	0.04
R4979:Tbr1	UTSW	2	61805249	splice site	probably null
R5283:Tbr1	UTSW	2	61804900	missense	probably benign	0.00
R5545:Tbr1	UTSW	2	61807376	missense	possibly damaging	0.93
R6178:Tbr1	UTSW	2	61804815	missense	possibly damaging	0.91
R6290:Tbr1	UTSW	2	61805050	missense	probably benign
R6389:Tbr1	UTSW	2	61806287	start gained	probably benign
R6637:Tbr1	UTSW	2	61811630	missense	probably benign	0.17
R6983:Tbr1	UTSW	2	61811735	missense	probably damaging	1.00
R7021:Tbr1	UTSW	2	61807344	missense	probably benign	0.18
R7112:Tbr1	UTSW	2	61811816	missense	probably benign	0.02
R7254:Tbr1	UTSW	2	61806042	missense	probably damaging	1.00
R7291:Tbr1	UTSW	2	61812256	missense	probably damaging	1.00
R7438:Tbr1	UTSW	2	61804817	missense	possibly damaging	0.92
R8253:Tbr1	UTSW	2	61805241	missense	probably benign	0.16
R8811:Tbr1	UTSW	2	61811852	missense	possibly damaging	0.89
R9258:Tbr1	UTSW	2	61812379	missense	probably benign	0.03
R9716:Tbr1	UTSW	2	61804733	missense	probably benign	0.12
Z1176:Tbr1	UTSW	2	61812147	missense	probably benign
Z1177:Tbr1	UTSW	2	61812231	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCTAGATCAGCAGACATTTCGTTC -3'
(R):5'- TAGGAAGTCATTGGCCGACC -3'

Sequencing Primer
(F):5'- GACATTTCGTTCAGACACGCG -3'
(R):5'- GGCCGACCGTTTTTAAAAAGTCG -3'

Posted On

2016-06-06