Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Nostrin'

390686

Institutional Source

Beutler Lab

Gene Symbol

Nostrin

Ensembl Gene

ENSMUSG00000034738

Gene Name

nitric oxide synthase trafficker

Synonyms

mDaIP2

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.255) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69135800-69189330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69175713 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 247 (Q247L)

Ref Sequence

ENSEMBL: ENSMUSP00000036923 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041865]

AlphaFold

Q6WKZ7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041865
AA Change: Q247L

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000036923
Gene: ENSMUSG00000034738
AA Change: Q247L

Domain	Start	End	E-Value	Type
Pfam:FCH	13	88	4.9e-12	PFAM
low complexity region	135	146	N/A	INTRINSIC
coiled coil region	160	190	N/A	INTRINSIC
coiled coil region	305	334	N/A	INTRINSIC
low complexity region	419	439	N/A	INTRINSIC
SH3	441	496	8.89e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141276

Meta Mutation Damage Score

0.0931

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide (NO) is a potent mediator in biologic processes such as neurotransmission, inflammatory response, and vascular homeostasis. NOSTRIN binds the enzyme responsible for NO production, endothelial NO synthase (ENOS; MIM 163729), and triggers the translocation of ENOS from the plasma membrane to vesicle-like subcellular structures, thereby attenuating ENOS-dependent NO production.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired retinal vascular angiogenesis, endothelial cell proliferation, endothelial cell migration and induced neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Atad5	T	A	11: 80,094,676	S196R	probably benign	Het
Bcam	T	A	7: 19,756,860		probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dock3	T	C	9: 106,937,906	Y1254C	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
Gpr45	A	G	1: 43,032,649	I151V	probably benign	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pam	C	A	1: 97,821,917	D839Y	probably damaging	Het
Pds5a	A	G	5: 65,637,814	V693A	probably damaging	Het
Pigo	A	T	4: 43,021,337	L535Q	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rad51c	T	C	11: 87,397,754	H201R	probably benign	Het
Rims2	A	T	15: 39,517,869		probably null	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Serpini2	T	A	3: 75,259,477	T158S	probably damaging	Het
Slc12a3	A	G	8: 94,346,351	R701G	probably damaging	Het
Slc1a6	A	G	10: 78,814,602	E558G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tbr1	A	T	2: 61,806,002	I241F	possibly damaging	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Nostrin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Nostrin	APN	2	69185554	splice site	probably benign
IGL00502:Nostrin	APN	2	69183992	missense	probably benign
IGL00767:Nostrin	APN	2	69175775	missense	probably benign	0.00
IGL00846:Nostrin	APN	2	69185555	splice site	probably benign
IGL00912:Nostrin	APN	2	69182819	splice site	probably benign
IGL02123:Nostrin	APN	2	69156109	splice site	probably benign
IGL02213:Nostrin	APN	2	69183918	missense	probably benign	0.25
R0295:Nostrin	UTSW	2	69179416	missense	probably benign	0.19
R0543:Nostrin	UTSW	2	69189131	makesense	probably null
R1384:Nostrin	UTSW	2	69189062	missense	probably benign	0.05
R1501:Nostrin	UTSW	2	69158785	missense	probably damaging	1.00
R1632:Nostrin	UTSW	2	69175734	missense	probably benign	0.21
R2012:Nostrin	UTSW	2	69144767	splice site	probably null
R2140:Nostrin	UTSW	2	69166003	missense	probably damaging	0.98
R2159:Nostrin	UTSW	2	69180922	splice site	probably null
R2329:Nostrin	UTSW	2	69161094	missense	probably damaging	1.00
R2890:Nostrin	UTSW	2	69180905	missense	probably benign
R4469:Nostrin	UTSW	2	69175717	missense	probably damaging	0.99
R4607:Nostrin	UTSW	2	69183899	missense	possibly damaging	0.89
R4608:Nostrin	UTSW	2	69183899	missense	possibly damaging	0.89
R4684:Nostrin	UTSW	2	69183924	missense	probably benign	0.00
R4719:Nostrin	UTSW	2	69144812	nonsense	probably null
R4846:Nostrin	UTSW	2	69175579	missense	probably damaging	1.00
R4911:Nostrin	UTSW	2	69161142	missense	possibly damaging	0.87
R4987:Nostrin	UTSW	2	69156431	missense	probably benign
R5177:Nostrin	UTSW	2	69175754	missense	possibly damaging	0.83
R6561:Nostrin	UTSW	2	69180857	missense	probably benign
R6785:Nostrin	UTSW	2	69183927	missense	probably benign	0.01
R6789:Nostrin	UTSW	2	69175512	missense	probably benign
R7453:Nostrin	UTSW	2	69183896	missense	possibly damaging	0.95
R7465:Nostrin	UTSW	2	69185507	missense	possibly damaging	0.93
R7570:Nostrin	UTSW	2	69175806	missense	probably damaging	0.98
R7761:Nostrin	UTSW	2	69161122	missense	possibly damaging	0.88
R7802:Nostrin	UTSW	2	69189012	missense	probably benign	0.18
R8115:Nostrin	UTSW	2	69180920	critical splice donor site	probably null
R8160:Nostrin	UTSW	2	69179466	missense	probably damaging	0.98
R8844:Nostrin	UTSW	2	69175716	missense	probably damaging	0.99
R9046:Nostrin	UTSW	2	69144779	missense	probably benign
X0021:Nostrin	UTSW	2	69144792	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTCACCGTGGAGTGTGTG -3'
(R):5'- ATACGTGGCCAAGATGAGCTG -3'

Sequencing Primer
(F):5'- TTCAGAGCATGCTGGAGC -3'
(R):5'- CCAAGATGAGCTGGTAAAGGCAC -3'

Posted On

2016-06-06