Incidental Mutation 'R5054:Eif2s2'
ID 390688
Institutional Source Beutler Lab
Gene Symbol Eif2s2
Ensembl Gene ENSMUSG00000074656
Gene Name eukaryotic translation initiation factor 2, subunit 2 (beta)
Synonyms 2810026E11Rik, D2Ertd303e, EIF2B, 38kDa, EIF2
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 154871410-154892935 bp(-) (GRCm38)
Type of Mutation splice site (20 bp from exon)
DNA Base Change (assembly) A to C at 154892670 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099173] [ENSMUST00000137333] [ENSMUST00000161172] [ENSMUST00000166171]
AlphaFold Q99L45
Predicted Effect probably null
Transcript: ENSMUST00000099173
SMART Domains Protein: ENSMUSP00000096777
Gene: ENSMUSG00000074656

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
low complexity region 123 132 N/A INTRINSIC
eIF2B_5 197 306 1.93e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135524
Predicted Effect probably benign
Transcript: ENSMUST00000137333
SMART Domains Protein: ENSMUSP00000122261
Gene: ENSMUSG00000027596

DomainStartEndE-ValueType
Agouti 6 70 2.53e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147136
Predicted Effect probably benign
Transcript: ENSMUST00000161172
SMART Domains Protein: ENSMUSP00000125248
Gene: ENSMUSG00000074656

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 74 82 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166171
SMART Domains Protein: ENSMUSP00000128257
Gene: ENSMUSG00000074656

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
low complexity region 123 132 N/A INTRINSIC
eIF2B_5 197 306 1.93e-68 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethallity prior to E8.5. Mice heterozygous for a gene trap allele exhibit reduced incidence of testicular germ cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,689,501 Y257H probably damaging Het
Adam28 C T 14: 68,617,715 C659Y probably damaging Het
Adamtsl2 G A 2: 27,101,720 E627K probably damaging Het
Atad5 T A 11: 80,094,676 S196R probably benign Het
Bcam T A 7: 19,756,860 probably benign Het
Birc6 A G 17: 74,655,325 H3978R probably damaging Het
Btbd7 T C 12: 102,838,212 I190V probably benign Het
Ccdc8 T C 7: 16,995,045 V153A probably damaging Het
Cyp2a5 C G 7: 26,841,104 R68G probably damaging Het
Dock3 T C 9: 106,937,906 Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 E2794G possibly damaging Het
Dytn C A 1: 63,661,159 V271L possibly damaging Het
Fndc7 A G 3: 108,881,347 S193P probably damaging Het
Fzr1 G A 10: 81,371,419 probably benign Het
Gm17472 T C 6: 42,981,004 I69T probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gmppa C A 1: 75,439,371 Y137* probably null Het
Gpr45 A G 1: 43,032,649 I151V probably benign Het
H1f0 G A 15: 79,028,773 A18T probably damaging Het
Hbb-bh1 C T 7: 103,841,856 V114I probably benign Het
Impa2 C A 18: 67,306,727 P98Q probably damaging Het
Kazn T C 4: 142,108,646 N573D unknown Het
Kcna2 A T 3: 107,104,340 D79V probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kif13a A G 13: 46,802,646 Y561H probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra1 T A 6: 130,375,284 Q165L probably damaging Het
Mat2b T A 11: 40,680,042 R318S probably damaging Het
Mgat4d G A 8: 83,368,208 probably null Het
Mtor T A 4: 148,556,855 probably null Het
Nostrin A T 2: 69,175,713 Q247L possibly damaging Het
Obscn T C 11: 59,073,617 E3033G probably damaging Het
Pam C A 1: 97,821,917 D839Y probably damaging Het
Pds5a A G 5: 65,637,814 V693A probably damaging Het
Pigo A T 4: 43,021,337 L535Q probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptar1 G T 19: 23,694,365 R44L probably damaging Het
Rad51c T C 11: 87,397,754 H201R probably benign Het
Rims2 A T 15: 39,517,869 probably null Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Rpl22l1 T G 3: 28,806,836 S67A possibly damaging Het
Rps10 A G 17: 27,630,480 S143P probably damaging Het
Rundc1 T C 11: 101,425,141 V13A probably benign Het
Sephs2 C A 7: 127,273,392 M176I probably benign Het
Serpina16 C T 12: 103,674,930 V179I probably benign Het
Serpini2 T A 3: 75,259,477 T158S probably damaging Het
Slc12a3 A G 8: 94,346,351 R701G probably damaging Het
Slc1a6 A G 10: 78,814,602 E558G probably damaging Het
Ssx2ip T C 3: 146,430,917 probably benign Het
Tbr1 A T 2: 61,806,002 I241F possibly damaging Het
Tgfa G C 6: 86,270,082 probably null Het
Tlr12 T A 4: 128,617,270 K396* probably null Het
Tmppe A G 9: 114,405,958 I442V probably benign Het
Tubb3 T C 8: 123,420,868 V180A probably damaging Het
Vmn1r222 A G 13: 23,232,731 V104A probably damaging Het
Vmn2r95 G T 17: 18,451,446 V482L possibly damaging Het
Zfp184 G T 13: 21,959,282 R386L possibly damaging Het
Zfp444 T A 7: 6,189,793 V270E probably damaging Het
Zfp985 A T 4: 147,582,981 Y102F probably damaging Het
Other mutations in Eif2s2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Eif2s2 APN 2 154887709 missense probably benign
R0414:Eif2s2 UTSW 2 154884461 splice site probably benign
R0631:Eif2s2 UTSW 2 154884358 missense probably damaging 0.99
R4480:Eif2s2 UTSW 2 154888270 missense probably benign
R4660:Eif2s2 UTSW 2 154888269 missense probably benign 0.17
R4735:Eif2s2 UTSW 2 154878547 splice site probably null
R8062:Eif2s2 UTSW 2 154877804 missense possibly damaging 0.82
R8163:Eif2s2 UTSW 2 154892701 missense probably benign 0.00
R8772:Eif2s2 UTSW 2 154887739 missense probably null
R9004:Eif2s2 UTSW 2 154878484 missense probably benign 0.37
R9491:Eif2s2 UTSW 2 154892710 start gained probably benign
R9767:Eif2s2 UTSW 2 154888205 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCATTCCGAAACGCCGATC -3'
(R):5'- CACTTCCAACGTTTGAGAGGAG -3'

Sequencing Primer
(F):5'- AAACGCCGATCACCGTGG -3'
(R):5'- CGTTTGAGAGGAGGGCGG -3'
Posted On 2016-06-06