Incidental Mutation 'R0437:Crx'
ID39069
Institutional Source Beutler Lab
Gene Symbol Crx
Ensembl Gene ENSMUSG00000041578
Gene Namecone-rod homeobox
SynonymsCrx1
MMRRC Submission 038638-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R0437 (G1)
Quality Score177
Status Validated
Chromosome7
Chromosomal Location15865947-15879968 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 15871146 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 57 (S57*)
Ref Sequence ENSEMBL: ENSMUSP00000134400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044434] [ENSMUST00000132563] [ENSMUST00000172758] [ENSMUST00000174318]
Predicted Effect probably null
Transcript: ENSMUST00000044434
AA Change: S33*
SMART Domains Protein: ENSMUSP00000043436
Gene: ENSMUSG00000041578
AA Change: S33*

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
Pfam:TF_Otx 164 250 1.1e-15 PFAM
internal_repeat_1 260 278 1.41e-5 PROSPERO
internal_repeat_1 279 296 1.41e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000132563
AA Change: S33*
SMART Domains Protein: ENSMUSP00000133833
Gene: ENSMUSG00000041578
AA Change: S33*

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
low complexity region 196 207 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165905
AA Change: S57*
SMART Domains Protein: ENSMUSP00000126642
Gene: ENSMUSG00000041578
AA Change: S57*

DomainStartEndE-ValueType
HOX 63 125 2.39e-24 SMART
low complexity region 163 177 N/A INTRINSIC
Pfam:TF_Otx 188 273 1.9e-17 PFAM
internal_repeat_1 284 302 2.45e-5 PROSPERO
internal_repeat_1 303 320 2.45e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000172758
AA Change: S33*
SMART Domains Protein: ENSMUSP00000134463
Gene: ENSMUSG00000041578
AA Change: S33*

DomainStartEndE-ValueType
HOX 39 74 6.07e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174318
AA Change: S57*
SMART Domains Protein: ENSMUSP00000134400
Gene: ENSMUSG00000041578
AA Change: S57*

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
Pfam:TF_Otx 164 250 1.1e-15 PFAM
internal_repeat_1 260 278 1.41e-5 PROSPERO
internal_repeat_1 279 296 1.41e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174358
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a photoreceptor-specific transcription factor which plays a role in the differentiation of photoreceptor cells. This homeodomain protein is necessary for the maintenance of normal cone and rod function. Mutations in this gene are associated with photoreceptor degeneration, Leber congenital amaurosis type III and the autosomal dominant cone-rod dystrophy 2. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a lack of photoreceptor outer segments and rod and cone activity, reduced expression of several photoreceptor- and pineal-specific genes, and altered circadian behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,953 L21P probably damaging Het
4833420G17Rik G A 13: 119,470,095 R291K probably benign Het
4932438A13Rik A T 3: 36,989,804 H2820L possibly damaging Het
Abca2 T C 2: 25,442,845 S1519P probably damaging Het
Abcb11 G A 2: 69,257,295 A1042V probably damaging Het
Abcc10 A T 17: 46,312,919 probably null Het
Abcc10 G T 17: 46,312,920 probably benign Het
Alkbh3 A C 2: 93,981,569 L240V probably damaging Het
Apol10b T C 15: 77,585,408 S190G probably benign Het
Atp1a3 C A 7: 24,998,967 C135F probably benign Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
BC030499 T C 11: 78,291,536 L57P probably benign Het
Bicra A G 7: 15,988,762 S277P possibly damaging Het
Bmp8a T C 4: 123,316,897 E275G probably benign Het
Ccdc102a T C 8: 94,913,426 E80G probably damaging Het
Cdh23 T C 10: 60,410,797 D954G probably damaging Het
Chrm4 A G 2: 91,928,443 T399A possibly damaging Het
Clcn3 A G 8: 60,934,537 V199A possibly damaging Het
Crlf1 T C 8: 70,499,514 probably null Het
Cyp4f16 A G 17: 32,537,098 I34V possibly damaging Het
Daxx T C 17: 33,913,624 V576A probably benign Het
Ddx17 C T 15: 79,537,471 R351H probably damaging Het
Dhx38 T C 8: 109,558,629 probably benign Het
Dnd1 T C 18: 36,764,499 probably benign Het
Dync1i2 A T 2: 71,227,825 probably null Het
E2f6 T C 12: 16,816,445 S52P probably benign Het
Epb41l4a A G 18: 33,880,273 F116S probably damaging Het
Ext1 T C 15: 53,106,106 N362S probably damaging Het
Fam227a C A 15: 79,643,988 K79N possibly damaging Het
Fam228a T A 12: 4,732,759 L111F probably damaging Het
Fat2 T C 11: 55,282,799 T2363A probably benign Het
Fat3 A T 9: 15,996,932 N2591K probably damaging Het
Frem2 A G 3: 53,653,015 M1357T possibly damaging Het
Frmd4b A T 6: 97,423,463 V29D probably damaging Het
G930045G22Rik A G 6: 50,846,938 noncoding transcript Het
Galnt3 A G 2: 66,107,229 S46P possibly damaging Het
Gmeb2 A G 2: 181,253,973 V468A possibly damaging Het
Herc2 C T 7: 56,219,815 R4271* probably null Het
Il5 C A 11: 53,723,906 probably benign Het
Ints9 G A 14: 64,986,369 probably benign Het
Itga10 T C 3: 96,649,137 F196S probably damaging Het
Itgb3bp T C 4: 99,781,889 T138A probably damaging Het
Kcnd1 G A X: 7,824,683 V281M probably benign Het
Lcp2 T C 11: 34,087,229 L391P probably benign Het
Lrrc66 T C 5: 73,607,687 Y671C probably benign Het
Mettl23 T C 11: 116,849,294 V197A possibly damaging Het
Mmp15 C A 8: 95,370,772 D456E probably benign Het
Mospd4 T C 18: 46,465,781 noncoding transcript Het
Mov10l1 C A 15: 89,005,312 H484N probably damaging Het
Mphosph9 T C 5: 124,315,568 Q197R probably benign Het
Ms4a1 T A 19: 11,256,569 probably null Het
Mybbp1a T C 11: 72,448,848 V919A possibly damaging Het
Mycbpap A T 11: 94,513,512 probably benign Het
Naip6 G A 13: 100,296,924 S1135F possibly damaging Het
Ndufc2 T A 7: 97,400,337 M50K probably benign Het
Npr2 T C 4: 43,648,082 V842A probably damaging Het
Ntsr2 G T 12: 16,653,695 G66W probably damaging Het
Obscn T C 11: 58,995,088 probably benign Het
Olfr1206 T A 2: 88,864,885 N93K probably benign Het
Olfr1219 T A 2: 89,074,612 I160F probably benign Het
Olfr427 G A 1: 174,100,399 G314R probably benign Het
Olfr820 T C 10: 130,018,096 V245A probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Otud4 T A 8: 79,669,997 H628Q probably benign Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pex16 G T 2: 92,375,592 R10L probably damaging Het
Pitpnm2 A G 5: 124,131,089 probably benign Het
Pom121l2 A G 13: 21,983,205 T549A possibly damaging Het
Prdm15 A T 16: 97,812,559 M470K probably benign Het
Prkag2 T A 5: 25,028,505 D49V possibly damaging Het
Prl3c1 A G 13: 27,199,464 M38V probably benign Het
Prpf18 T A 2: 4,643,761 I85F possibly damaging Het
Psg27 A G 7: 18,560,711 probably benign Het
Relt A G 7: 100,848,784 probably benign Het
Serpina3b A T 12: 104,130,670 N70I probably damaging Het
Slc19a3 T C 1: 83,022,565 S244G probably benign Het
Slc39a5 T C 10: 128,399,847 T81A possibly damaging Het
Slc7a2 G A 8: 40,904,526 G277D probably damaging Het
Slc9c1 C T 16: 45,599,887 probably benign Het
Slx1b A G 7: 126,692,581 F104L probably benign Het
Smg6 G A 11: 74,929,701 S266N probably damaging Het
Spata9 T C 13: 75,998,495 V162A possibly damaging Het
Szrd1 T C 4: 141,118,744 I47V probably benign Het
Tha1 G T 11: 117,868,575 L363M probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Tmem132d C T 5: 127,789,785 G684R probably damaging Het
Trim55 G A 3: 19,670,978 G220S probably benign Het
Ttn A G 2: 76,770,530 L18836P probably damaging Het
Ubn1 G T 16: 5,072,184 probably benign Het
Ush2a T G 1: 188,911,031 W4197G probably benign Het
Vmn1r189 A T 13: 22,102,061 V202E probably damaging Het
Vmn1r209 T C 13: 22,806,356 I55V probably benign Het
Vmn2r86 A T 10: 130,446,543 C735S probably damaging Het
Vwf A T 6: 125,566,318 D174V probably damaging Het
Zfp438 T C 18: 5,214,910 N16S probably damaging Het
Zfp444 C T 7: 6,189,409 T142I probably benign Het
Zfp804a A G 2: 82,053,791 M1V probably null Het
Zfp936 T G 7: 43,189,310 I67S probably benign Het
Zfp948 A T 17: 21,586,998 N151Y unknown Het
Other mutations in Crx
AlleleSourceChrCoordTypePredicted EffectPPH Score
Typhlotic UTSW 7 15868107 nonsense probably null
R0729:Crx UTSW 7 15871133 splice site probably benign
R1601:Crx UTSW 7 15867811 splice site probably null
R1898:Crx UTSW 7 15868223 missense probably damaging 1.00
R1933:Crx UTSW 7 15868376 nonsense probably null
R1988:Crx UTSW 7 15869347 missense possibly damaging 0.95
R5272:Crx UTSW 7 15868285 missense probably damaging 0.99
R5326:Crx UTSW 7 15868337 missense probably damaging 1.00
R5542:Crx UTSW 7 15868337 missense probably damaging 1.00
R6134:Crx UTSW 7 15868107 nonsense probably null
R7313:Crx UTSW 7 15867932 missense probably damaging 1.00
R8458:Crx UTSW 7 15868106 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TGGTGAAGGACTTCAATCTCAGCAC -3'
(R):5'- TGGGCAGAGTAGTCTGTTGGACAC -3'

Sequencing Primer
(F):5'- tccagcccaaaaacctctac -3'
(R):5'- GGACACCCTGTTCTCTTGTAG -3'
Posted On2013-05-23