Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Serpini2'

390690

Institutional Source

Beutler Lab

Gene Symbol

Serpini2

Ensembl Gene

ENSMUSG00000034139

Gene Name

serine (or cysteine) peptidase inhibitor, clade I, member 2

Synonyms

1810006A24Rik

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75242370-75270078 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75259477 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 158 (T158S)

Ref Sequence

ENSEMBL: ENSMUSP00000046943 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039047]

AlphaFold

Q9JK88

Predicted Effect

probably damaging
Transcript: ENSMUST00000039047
AA Change: T158S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046943
Gene: ENSMUSG00000034139
AA Change: T158S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SERPIN	31	392	8.75e-130	SMART

Meta Mutation Damage Score

0.1240

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of a family of proteins that acts as inhibitors of serine proteases. These proteins function in the regulation of a variety of physiological processes, including coagulation, fibrinolysis, development, malignancy, and inflammation. Expression of the encoded protein may be downregulated during pancreatic carcinogenesis. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgene insertion/deletion encompassing this gene display pancreatic insufficiency characterized by progressive apoptosis of pancreatic acinar cells, postnatal growth retardation, immunological anomalies, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Atad5	T	A	11: 80,094,676	S196R	probably benign	Het
Bcam	T	A	7: 19,756,860		probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dock3	T	C	9: 106,937,906	Y1254C	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
Gpr45	A	G	1: 43,032,649	I151V	probably benign	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Nostrin	A	T	2: 69,175,713	Q247L	possibly damaging	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pam	C	A	1: 97,821,917	D839Y	probably damaging	Het
Pds5a	A	G	5: 65,637,814	V693A	probably damaging	Het
Pigo	A	T	4: 43,021,337	L535Q	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rad51c	T	C	11: 87,397,754	H201R	probably benign	Het
Rims2	A	T	15: 39,517,869		probably null	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Slc12a3	A	G	8: 94,346,351	R701G	probably damaging	Het
Slc1a6	A	G	10: 78,814,602	E558G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tbr1	A	T	2: 61,806,002	I241F	possibly damaging	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Serpini2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Serpini2	APN	3	75249242	missense	probably damaging	1.00
IGL00736:Serpini2	APN	3	75267809	missense	possibly damaging	0.70
IGL03398:Serpini2	APN	3	75259545	missense	probably benign	0.00
R0271:Serpini2	UTSW	3	75246578	missense	probably damaging	1.00
R0545:Serpini2	UTSW	3	75258138	missense	probably benign	0.04
R2309:Serpini2	UTSW	3	75259690	missense	probably damaging	0.99
R2435:Serpini2	UTSW	3	75258168	missense	probably benign	0.00
R2886:Serpini2	UTSW	3	75259614	missense	probably damaging	1.00
R5151:Serpini2	UTSW	3	75246513	missense	possibly damaging	0.93
R5554:Serpini2	UTSW	3	75267988	start gained	probably benign
R5614:Serpini2	UTSW	3	75257707	intron	probably benign
R6413:Serpini2	UTSW	3	75259614	missense	probably damaging	1.00
R6510:Serpini2	UTSW	3	75252568	missense	probably damaging	0.97
R6688:Serpini2	UTSW	3	75259563	missense	possibly damaging	0.88
R7178:Serpini2	UTSW	3	75258148	missense	probably damaging	1.00
R8491:Serpini2	UTSW	3	75252515	missense	probably damaging	1.00
R9586:Serpini2	UTSW	3	75259584	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGCCATTCAGTTTCCTTGGG -3'
(R):5'- GAGGAATTTTCTGTGTTGAAGTCAC -3'

Sequencing Primer
(F):5'- CCATTCAGTTTCCTTGGGTTGTATAG -3'
(R):5'- TTTTCAGCCATCTCAAAGAAGAAGC -3'

Posted On

2016-06-06