Incidental Mutation 'R5054:Fndc7'
ID390692
Institutional Source Beutler Lab
Gene Symbol Fndc7
Ensembl Gene ENSMUSG00000045326
Gene Namefibronectin type III domain containing 7
Synonyms
MMRRC Submission 042644-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5054 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108853678-108890008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108881347 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 193 (S193P)
Ref Sequence ENSEMBL: ENSMUSP00000136215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053065] [ENSMUST00000102620] [ENSMUST00000180063]
Predicted Effect probably damaging
Transcript: ENSMUST00000053065
AA Change: S193P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051172
Gene: ENSMUSG00000045326
AA Change: S193P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
Blast:FN3 201 274 9e-44 BLAST
FN3 283 360 1.07e-1 SMART
FN3 457 530 5.1e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102620
AA Change: S193P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099680
Gene: ENSMUSG00000045326
AA Change: S193P

DomainStartEndE-ValueType
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
FN3 201 275 2.44e-5 SMART
Blast:FN3 287 360 1e-43 BLAST
FN3 369 446 1.07e-1 SMART
FN3 543 616 5.1e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139137
SMART Domains Protein: ENSMUSP00000117562
Gene: ENSMUSG00000045326

DomainStartEndE-ValueType
Blast:FN3 1 123 3e-27 BLAST
SCOP:d1f6fb2 3 64 3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180063
AA Change: S193P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136215
Gene: ENSMUSG00000045326
AA Change: S193P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
FN3 201 275 2.44e-5 SMART
Blast:FN3 287 360 2e-43 BLAST
FN3 369 446 1.07e-1 SMART
FN3 543 616 5.1e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196867
Meta Mutation Damage Score 0.1431 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,689,501 Y257H probably damaging Het
Adam28 C T 14: 68,617,715 C659Y probably damaging Het
Adamtsl2 G A 2: 27,101,720 E627K probably damaging Het
Atad5 T A 11: 80,094,676 S196R probably benign Het
Bcam T A 7: 19,756,860 probably benign Het
Birc6 A G 17: 74,655,325 H3978R probably damaging Het
Btbd7 T C 12: 102,838,212 I190V probably benign Het
Ccdc8 T C 7: 16,995,045 V153A probably damaging Het
Cyp2a5 C G 7: 26,841,104 R68G probably damaging Het
Dock3 T C 9: 106,937,906 Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 E2794G possibly damaging Het
Dytn C A 1: 63,661,159 V271L possibly damaging Het
Eif2s2 A C 2: 154,892,670 probably null Het
Fzr1 G A 10: 81,371,419 probably benign Het
Gm17472 T C 6: 42,981,004 I69T probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gmppa C A 1: 75,439,371 Y137* probably null Het
Gpr45 A G 1: 43,032,649 I151V probably benign Het
H1f0 G A 15: 79,028,773 A18T probably damaging Het
Hbb-bh1 C T 7: 103,841,856 V114I probably benign Het
Impa2 C A 18: 67,306,727 P98Q probably damaging Het
Kazn T C 4: 142,108,646 N573D unknown Het
Kcna2 A T 3: 107,104,340 D79V probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kif13a A G 13: 46,802,646 Y561H probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra1 T A 6: 130,375,284 Q165L probably damaging Het
Mat2b T A 11: 40,680,042 R318S probably damaging Het
Mgat4d G A 8: 83,368,208 probably null Het
Mtor T A 4: 148,556,855 probably null Het
Nostrin A T 2: 69,175,713 Q247L possibly damaging Het
Obscn T C 11: 59,073,617 E3033G probably damaging Het
Pam C A 1: 97,821,917 D839Y probably damaging Het
Pds5a A G 5: 65,637,814 V693A probably damaging Het
Pigo A T 4: 43,021,337 L535Q probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptar1 G T 19: 23,694,365 R44L probably damaging Het
Rad51c T C 11: 87,397,754 H201R probably benign Het
Rims2 A T 15: 39,517,869 probably null Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Rpl22l1 T G 3: 28,806,836 S67A possibly damaging Het
Rps10 A G 17: 27,630,480 S143P probably damaging Het
Rundc1 T C 11: 101,425,141 V13A probably benign Het
Sephs2 C A 7: 127,273,392 M176I probably benign Het
Serpina16 C T 12: 103,674,930 V179I probably benign Het
Serpini2 T A 3: 75,259,477 T158S probably damaging Het
Slc12a3 A G 8: 94,346,351 R701G probably damaging Het
Slc1a6 A G 10: 78,814,602 E558G probably damaging Het
Ssx2ip T C 3: 146,430,917 probably benign Het
Tbr1 A T 2: 61,806,002 I241F possibly damaging Het
Tgfa G C 6: 86,270,082 probably null Het
Tlr12 T A 4: 128,617,270 K396* probably null Het
Tmppe A G 9: 114,405,958 I442V probably benign Het
Tubb3 T C 8: 123,420,868 V180A probably damaging Het
Vmn1r222 A G 13: 23,232,731 V104A probably damaging Het
Vmn2r95 G T 17: 18,451,446 V482L possibly damaging Het
Zfp184 G T 13: 21,959,282 R386L possibly damaging Het
Zfp444 T A 7: 6,189,793 V270E probably damaging Het
Zfp985 A T 4: 147,582,981 Y102F probably damaging Het
Other mutations in Fndc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02077:Fndc7 APN 3 108883468 missense probably benign 0.17
IGL02823:Fndc7 APN 3 108869171 missense probably damaging 1.00
IGL02896:Fndc7 APN 3 108862931 missense probably benign 0.04
IGL03196:Fndc7 APN 3 108883444 missense probably damaging 1.00
IGL03343:Fndc7 APN 3 108867308 missense probably damaging 1.00
IGL03377:Fndc7 APN 3 108876532 missense probably benign 0.12
R0240:Fndc7 UTSW 3 108858919 splice site probably benign
R0324:Fndc7 UTSW 3 108876699 splice site probably null
R0457:Fndc7 UTSW 3 108876545 missense probably benign 0.02
R0630:Fndc7 UTSW 3 108876615 missense probably damaging 1.00
R0891:Fndc7 UTSW 3 108870588 missense possibly damaging 0.54
R1752:Fndc7 UTSW 3 108869330 missense probably benign 0.14
R1772:Fndc7 UTSW 3 108870534 missense probably damaging 1.00
R1923:Fndc7 UTSW 3 108876687 missense probably benign 0.00
R1957:Fndc7 UTSW 3 108883509 missense probably damaging 0.98
R3801:Fndc7 UTSW 3 108869148 missense possibly damaging 0.95
R4592:Fndc7 UTSW 3 108858902 missense probably damaging 1.00
R4650:Fndc7 UTSW 3 108862819 missense probably benign 0.15
R4652:Fndc7 UTSW 3 108862819 missense probably benign 0.15
R4791:Fndc7 UTSW 3 108876659 missense probably benign 0.00
R4933:Fndc7 UTSW 3 108876670 missense probably benign 0.01
R5004:Fndc7 UTSW 3 108883473 missense probably damaging 1.00
R5042:Fndc7 UTSW 3 108862786 missense probably damaging 1.00
R5175:Fndc7 UTSW 3 108869166 missense probably benign 0.04
R5325:Fndc7 UTSW 3 108883449 missense probably damaging 1.00
R5571:Fndc7 UTSW 3 108856408 missense possibly damaging 0.68
R5638:Fndc7 UTSW 3 108862892 missense possibly damaging 0.69
R5846:Fndc7 UTSW 3 108881391 missense probably damaging 1.00
R6488:Fndc7 UTSW 3 108870575 missense probably damaging 0.99
R6737:Fndc7 UTSW 3 108872278 missense probably damaging 1.00
R6993:Fndc7 UTSW 3 108876591 missense probably benign 0.00
R6998:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R6999:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7000:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7001:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7181:Fndc7 UTSW 3 108881324 critical splice donor site probably null
R7324:Fndc7 UTSW 3 108872221 missense probably benign 0.06
R7425:Fndc7 UTSW 3 108876659 missense probably benign 0.00
R7631:Fndc7 UTSW 3 108869252 missense probably damaging 1.00
R7702:Fndc7 UTSW 3 108862813 missense probably damaging 0.98
R7713:Fndc7 UTSW 3 108870663 missense possibly damaging 0.90
Z1088:Fndc7 UTSW 3 108883500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCAACTACTGCCGAGGGG -3'
(R):5'- ACTCAATCCTTGTGAGCTGGG -3'

Sequencing Primer
(F):5'- GGCAAGGCCCTATAAATAACTTC -3'
(R):5'- AGCTGGGACGCCGTATACATG -3'
Posted On2016-06-06