Incidental Mutation 'R5054:Ssx2ip'
ID390693
Institutional Source Beutler Lab
Gene Symbol Ssx2ip
Ensembl Gene ENSMUSG00000036825
Gene Namesynovial sarcoma, X 2 interacting protein
SynonymsAdip
MMRRC Submission 042644-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5054 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146404642-146440144 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 146430917 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039021] [ENSMUST00000106149] [ENSMUST00000106151] [ENSMUST00000106153]
Predicted Effect probably benign
Transcript: ENSMUST00000039021
SMART Domains Protein: ENSMUSP00000045663
Gene: ENSMUSG00000036825

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106149
SMART Domains Protein: ENSMUSP00000101755
Gene: ENSMUSG00000036825

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106151
SMART Domains Protein: ENSMUSP00000101757
Gene: ENSMUSG00000036825

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106153
SMART Domains Protein: ENSMUSP00000101759
Gene: ENSMUSG00000036825

DomainStartEndE-ValueType
Pfam:ADIP 63 214 1.2e-47 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 410 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
Blast:LPD_N 440 481 3e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141103
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the cancer-testis antigen Synovial Sarcoma X breakpoint 2 protein. The encoded protein may regulate the activity of Synovial Sarcoma X breakpoint 2 protein in malignant cells. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,689,501 Y257H probably damaging Het
Adam28 C T 14: 68,617,715 C659Y probably damaging Het
Adamtsl2 G A 2: 27,101,720 E627K probably damaging Het
Atad5 T A 11: 80,094,676 S196R probably benign Het
Bcam T A 7: 19,756,860 probably benign Het
Birc6 A G 17: 74,655,325 H3978R probably damaging Het
Btbd7 T C 12: 102,838,212 I190V probably benign Het
Ccdc8 T C 7: 16,995,045 V153A probably damaging Het
Cyp2a5 C G 7: 26,841,104 R68G probably damaging Het
Dock3 T C 9: 106,937,906 Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 E2794G possibly damaging Het
Dytn C A 1: 63,661,159 V271L possibly damaging Het
Eif2s2 A C 2: 154,892,670 probably null Het
Fndc7 A G 3: 108,881,347 S193P probably damaging Het
Fzr1 G A 10: 81,371,419 probably benign Het
Gm17472 T C 6: 42,981,004 I69T probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gmppa C A 1: 75,439,371 Y137* probably null Het
Gpr45 A G 1: 43,032,649 I151V probably benign Het
H1f0 G A 15: 79,028,773 A18T probably damaging Het
Hbb-bh1 C T 7: 103,841,856 V114I probably benign Het
Impa2 C A 18: 67,306,727 P98Q probably damaging Het
Kazn T C 4: 142,108,646 N573D unknown Het
Kcna2 A T 3: 107,104,340 D79V probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kif13a A G 13: 46,802,646 Y561H probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra1 T A 6: 130,375,284 Q165L probably damaging Het
Mat2b T A 11: 40,680,042 R318S probably damaging Het
Mgat4d G A 8: 83,368,208 probably null Het
Mtor T A 4: 148,556,855 probably null Het
Nostrin A T 2: 69,175,713 Q247L possibly damaging Het
Obscn T C 11: 59,073,617 E3033G probably damaging Het
Pam C A 1: 97,821,917 D839Y probably damaging Het
Pds5a A G 5: 65,637,814 V693A probably damaging Het
Pigo A T 4: 43,021,337 L535Q probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptar1 G T 19: 23,694,365 R44L probably damaging Het
Rad51c T C 11: 87,397,754 H201R probably benign Het
Rims2 A T 15: 39,517,869 probably null Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Rpl22l1 T G 3: 28,806,836 S67A possibly damaging Het
Rps10 A G 17: 27,630,480 S143P probably damaging Het
Rundc1 T C 11: 101,425,141 V13A probably benign Het
Sephs2 C A 7: 127,273,392 M176I probably benign Het
Serpina16 C T 12: 103,674,930 V179I probably benign Het
Serpini2 T A 3: 75,259,477 T158S probably damaging Het
Slc12a3 A G 8: 94,346,351 R701G probably damaging Het
Slc1a6 A G 10: 78,814,602 E558G probably damaging Het
Tbr1 A T 2: 61,806,002 I241F possibly damaging Het
Tgfa G C 6: 86,270,082 probably null Het
Tlr12 T A 4: 128,617,270 K396* probably null Het
Tmppe A G 9: 114,405,958 I442V probably benign Het
Tubb3 T C 8: 123,420,868 V180A probably damaging Het
Vmn1r222 A G 13: 23,232,731 V104A probably damaging Het
Vmn2r95 G T 17: 18,451,446 V482L possibly damaging Het
Zfp184 G T 13: 21,959,282 R386L possibly damaging Het
Zfp444 T A 7: 6,189,793 V270E probably damaging Het
Zfp985 A T 4: 147,582,981 Y102F probably damaging Het
Other mutations in Ssx2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Ssx2ip APN 3 146436552 missense probably damaging 1.00
IGL01140:Ssx2ip APN 3 146427843 missense probably benign 0.02
IGL01810:Ssx2ip APN 3 146428010 missense probably benign 0.00
BB004:Ssx2ip UTSW 3 146432610 missense probably damaging 1.00
BB014:Ssx2ip UTSW 3 146432610 missense probably damaging 1.00
R0432:Ssx2ip UTSW 3 146426429 missense probably damaging 1.00
R0903:Ssx2ip UTSW 3 146430977 missense probably benign
R2228:Ssx2ip UTSW 3 146417776 missense probably damaging 0.98
R3151:Ssx2ip UTSW 3 146418383 missense probably benign 0.00
R4348:Ssx2ip UTSW 3 146432490 missense probably benign 0.01
R4446:Ssx2ip UTSW 3 146426431 missense probably benign 0.31
R4796:Ssx2ip UTSW 3 146418359 missense probably benign 0.02
R5338:Ssx2ip UTSW 3 146436541 critical splice acceptor site probably null
R5520:Ssx2ip UTSW 3 146437311 missense probably benign 0.03
R5898:Ssx2ip UTSW 3 146427831 missense possibly damaging 0.94
R6367:Ssx2ip UTSW 3 146419166 missense probably benign 0.16
R6777:Ssx2ip UTSW 3 146438721 missense possibly damaging 0.88
R7082:Ssx2ip UTSW 3 146430948 missense probably benign 0.01
R7239:Ssx2ip UTSW 3 146428016 missense probably damaging 1.00
R7249:Ssx2ip UTSW 3 146426438 missense possibly damaging 0.81
R7772:Ssx2ip UTSW 3 146433130 missense probably damaging 0.99
R7927:Ssx2ip UTSW 3 146432610 missense probably damaging 1.00
R7935:Ssx2ip UTSW 3 146419173 missense probably benign 0.00
R8011:Ssx2ip UTSW 3 146422911 missense probably damaging 0.97
RF004:Ssx2ip UTSW 3 146426440 nonsense probably null
Z1177:Ssx2ip UTSW 3 146428147 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTATTCAGCACAGTATTGC -3'
(R):5'- TGCTGTTCCTGGGACTGAAC -3'

Sequencing Primer
(F):5'- TATTGCATAGACAGGGGCTGCC -3'
(R):5'- AGCACCCCCTCTGCATG -3'
Posted On2016-06-06