Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Pigo'

390694

Institutional Source

Beutler Lab

Gene Symbol

Pigo

Ensembl Gene

ENSMUSG00000028454

Gene Name

phosphatidylinositol glycan anchor biosynthesis, class O

Synonyms

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43017635-43025819 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43021337 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 535 (L535Q)

Ref Sequence

ENSEMBL: ENSMUSP00000095713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067481] [ENSMUST00000098109]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000067481
AA Change: L527Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069749
Gene: ENSMUSG00000028454
AA Change: L527Q

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:Phosphodiest	173	300	7.3e-17	PFAM
low complexity region	308	321	N/A	INTRINSIC
low complexity region	323	336	N/A	INTRINSIC
low complexity region	349	360	N/A	INTRINSIC
low complexity region	417	428	N/A	INTRINSIC
transmembrane domain	448	470	N/A	INTRINSIC
transmembrane domain	477	499	N/A	INTRINSIC
transmembrane domain	509	528	N/A	INTRINSIC
low complexity region	539	559	N/A	INTRINSIC
transmembrane domain	669	688	N/A	INTRINSIC
transmembrane domain	703	722	N/A	INTRINSIC
transmembrane domain	743	765	N/A	INTRINSIC
transmembrane domain	829	851	N/A	INTRINSIC
transmembrane domain	858	880	N/A	INTRINSIC
transmembrane domain	921	940	N/A	INTRINSIC
low complexity region	955	979	N/A	INTRINSIC
transmembrane domain	992	1014	N/A	INTRINSIC
transmembrane domain	1029	1051	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098109
AA Change: L535Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095713
Gene: ENSMUSG00000028454
AA Change: L535Q

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Phosphodiest	129	304	6.5e-18	PFAM
low complexity region	316	329	N/A	INTRINSIC
low complexity region	331	344	N/A	INTRINSIC
low complexity region	357	368	N/A	INTRINSIC
low complexity region	425	436	N/A	INTRINSIC
transmembrane domain	456	478	N/A	INTRINSIC
transmembrane domain	485	507	N/A	INTRINSIC
transmembrane domain	517	536	N/A	INTRINSIC
low complexity region	547	567	N/A	INTRINSIC
transmembrane domain	677	696	N/A	INTRINSIC
transmembrane domain	711	730	N/A	INTRINSIC
transmembrane domain	751	773	N/A	INTRINSIC
transmembrane domain	837	859	N/A	INTRINSIC
transmembrane domain	866	888	N/A	INTRINSIC
transmembrane domain	953	972	N/A	INTRINSIC
low complexity region	987	1011	N/A	INTRINSIC
transmembrane domain	1024	1046	N/A	INTRINSIC
transmembrane domain	1061	1083	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131506

Predicted Effect

probably benign
Transcript: ENSMUST00000149333

SMART Domains

Protein: ENSMUSP00000114917
Gene: ENSMUSG00000028454

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:Phosphodiest	123	299	2.7e-18	PFAM
low complexity region	311	324	N/A	INTRINSIC
low complexity region	326	339	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
low complexity region	420	431	N/A	INTRINSIC
low complexity region	450	460	N/A	INTRINSIC
transmembrane domain	531	550	N/A	INTRINSIC
low complexity region	565	589	N/A	INTRINSIC
transmembrane domain	602	624	N/A	INTRINSIC
transmembrane domain	639	661	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155429

Meta Mutation Damage Score

0.3109

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This protein is involved in the transfer of ethanolaminephosphate (EtNP) to the third mannose in GPI. At least three alternatively spliced transcripts encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Atad5	T	A	11: 80,094,676	S196R	probably benign	Het
Bcam	T	A	7: 19,756,860		probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dock3	T	C	9: 106,937,906	Y1254C	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
Gpr45	A	G	1: 43,032,649	I151V	probably benign	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Nostrin	A	T	2: 69,175,713	Q247L	possibly damaging	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pam	C	A	1: 97,821,917	D839Y	probably damaging	Het
Pds5a	A	G	5: 65,637,814	V693A	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rad51c	T	C	11: 87,397,754	H201R	probably benign	Het
Rims2	A	T	15: 39,517,869		probably null	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Serpini2	T	A	3: 75,259,477	T158S	probably damaging	Het
Slc12a3	A	G	8: 94,346,351	R701G	probably damaging	Het
Slc1a6	A	G	10: 78,814,602	E558G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tbr1	A	T	2: 61,806,002	I241F	possibly damaging	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Pigo

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Pigo	APN	4	43021767	missense	possibly damaging	0.63
IGL02176:Pigo	APN	4	43019352	missense	probably benign	0.20
IGL03197:Pigo	APN	4	43022103	missense	possibly damaging	0.92
R0207:Pigo	UTSW	4	43023824	splice site	probably benign
R0464:Pigo	UTSW	4	43019814	missense	probably benign	0.02
R0891:Pigo	UTSW	4	43020519	nonsense	probably null
R1445:Pigo	UTSW	4	43021460	missense	probably benign
R1484:Pigo	UTSW	4	43024779	missense	probably damaging	0.99
R1547:Pigo	UTSW	4	43020689	missense	probably benign	0.01
R1624:Pigo	UTSW	4	43024661	missense	probably damaging	1.00
R1847:Pigo	UTSW	4	43024710	nonsense	probably null
R3110:Pigo	UTSW	4	43021083	missense	probably benign	0.00
R3111:Pigo	UTSW	4	43021083	missense	probably benign	0.00
R3112:Pigo	UTSW	4	43021083	missense	probably benign	0.00
R3824:Pigo	UTSW	4	43020909	missense	possibly damaging	0.95
R3850:Pigo	UTSW	4	43025084	missense	probably benign	0.01
R3980:Pigo	UTSW	4	43019231	missense	probably damaging	1.00
R3982:Pigo	UTSW	4	43023482	missense	probably benign	0.00
R4520:Pigo	UTSW	4	43020301	missense	probably benign	0.16
R5033:Pigo	UTSW	4	43019412	missense	probably null	1.00
R5240:Pigo	UTSW	4	43020675	missense	possibly damaging	0.95
R5390:Pigo	UTSW	4	43019645	critical splice donor site	probably null
R5468:Pigo	UTSW	4	43024562	critical splice donor site	probably null
R5775:Pigo	UTSW	4	43023475	missense	probably damaging	1.00
R5839:Pigo	UTSW	4	43022104	missense	probably damaging	1.00
R5924:Pigo	UTSW	4	43023389	nonsense	probably null
R6111:Pigo	UTSW	4	43019724	missense	probably benign	0.18
R6451:Pigo	UTSW	4	43021412	missense	probably benign
R6533:Pigo	UTSW	4	43022697	missense	probably benign	0.07
R6884:Pigo	UTSW	4	43022627	missense	possibly damaging	0.88
R7026:Pigo	UTSW	4	43023380	nonsense	probably null
R7591:Pigo	UTSW	4	43025093	missense	probably benign
R7876:Pigo	UTSW	4	43020671	missense	probably benign	0.00
R8754:Pigo	UTSW	4	43024724	missense	probably benign	0.39
R8794:Pigo	UTSW	4	43023787	missense	possibly damaging	0.48
R9646:Pigo	UTSW	4	43017967	missense	probably damaging	0.99
R9782:Pigo	UTSW	4	43023475	missense	probably damaging	1.00
Z1088:Pigo	UTSW	4	43019409	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCGAGCCTTGTAAATAAAAGC -3'
(R):5'- TTCTCTCTGGTCCGAATGGC -3'

Sequencing Primer
(F):5'- AGTAGCTGACCCTCCCAGTG -3'
(R):5'- TGGTCCGAATGGCAGGGG -3'

Posted On

2016-06-06