Incidental Mutation 'R5054:Pigo'
List |< first << previous [record 36 of 60] next >> last >|
ID390694
Institutional Source Beutler Lab
Gene Symbol Pigo
Ensembl Gene ENSMUSG00000028454
Gene Namephosphatidylinositol glycan anchor biosynthesis, class O
Synonyms
MMRRC Submission 042644-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5054 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43017635-43025819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43021337 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 535 (L535Q)
Ref Sequence ENSEMBL: ENSMUSP00000095713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067481] [ENSMUST00000098109]
Predicted Effect probably damaging
Transcript: ENSMUST00000067481
AA Change: L527Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069749
Gene: ENSMUSG00000028454
AA Change: L527Q

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 173 300 7.3e-17 PFAM
low complexity region 308 321 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
low complexity region 349 360 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 509 528 N/A INTRINSIC
low complexity region 539 559 N/A INTRINSIC
transmembrane domain 669 688 N/A INTRINSIC
transmembrane domain 703 722 N/A INTRINSIC
transmembrane domain 743 765 N/A INTRINSIC
transmembrane domain 829 851 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 921 940 N/A INTRINSIC
low complexity region 955 979 N/A INTRINSIC
transmembrane domain 992 1014 N/A INTRINSIC
transmembrane domain 1029 1051 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098109
AA Change: L535Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095713
Gene: ENSMUSG00000028454
AA Change: L535Q

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Phosphodiest 129 304 6.5e-18 PFAM
low complexity region 316 329 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 357 368 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
transmembrane domain 456 478 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 517 536 N/A INTRINSIC
low complexity region 547 567 N/A INTRINSIC
transmembrane domain 677 696 N/A INTRINSIC
transmembrane domain 711 730 N/A INTRINSIC
transmembrane domain 751 773 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 866 888 N/A INTRINSIC
transmembrane domain 953 972 N/A INTRINSIC
low complexity region 987 1011 N/A INTRINSIC
transmembrane domain 1024 1046 N/A INTRINSIC
transmembrane domain 1061 1083 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131506
Predicted Effect probably benign
Transcript: ENSMUST00000149333
SMART Domains Protein: ENSMUSP00000114917
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 123 299 2.7e-18 PFAM
low complexity region 311 324 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
transmembrane domain 531 550 N/A INTRINSIC
low complexity region 565 589 N/A INTRINSIC
transmembrane domain 602 624 N/A INTRINSIC
transmembrane domain 639 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155429
Meta Mutation Damage Score 0.3109 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This protein is involved in the transfer of ethanolaminephosphate (EtNP) to the third mannose in GPI. At least three alternatively spliced transcripts encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,689,501 Y257H probably damaging Het
Adam28 C T 14: 68,617,715 C659Y probably damaging Het
Adamtsl2 G A 2: 27,101,720 E627K probably damaging Het
Atad5 T A 11: 80,094,676 S196R probably benign Het
Bcam T A 7: 19,756,860 probably benign Het
Birc6 A G 17: 74,655,325 H3978R probably damaging Het
Btbd7 T C 12: 102,838,212 I190V probably benign Het
Ccdc8 T C 7: 16,995,045 V153A probably damaging Het
Cyp2a5 C G 7: 26,841,104 R68G probably damaging Het
Dock3 T C 9: 106,937,906 Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 E2794G possibly damaging Het
Dytn C A 1: 63,661,159 V271L possibly damaging Het
Eif2s2 A C 2: 154,892,670 probably null Het
Fndc7 A G 3: 108,881,347 S193P probably damaging Het
Fzr1 G A 10: 81,371,419 probably benign Het
Gm17472 T C 6: 42,981,004 I69T probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gmppa C A 1: 75,439,371 Y137* probably null Het
Gpr45 A G 1: 43,032,649 I151V probably benign Het
H1f0 G A 15: 79,028,773 A18T probably damaging Het
Hbb-bh1 C T 7: 103,841,856 V114I probably benign Het
Impa2 C A 18: 67,306,727 P98Q probably damaging Het
Kazn T C 4: 142,108,646 N573D unknown Het
Kcna2 A T 3: 107,104,340 D79V probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kif13a A G 13: 46,802,646 Y561H probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra1 T A 6: 130,375,284 Q165L probably damaging Het
Mat2b T A 11: 40,680,042 R318S probably damaging Het
Mgat4d G A 8: 83,368,208 probably null Het
Mtor T A 4: 148,556,855 probably null Het
Nostrin A T 2: 69,175,713 Q247L possibly damaging Het
Obscn T C 11: 59,073,617 E3033G probably damaging Het
Pam C A 1: 97,821,917 D839Y probably damaging Het
Pds5a A G 5: 65,637,814 V693A probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptar1 G T 19: 23,694,365 R44L probably damaging Het
Rad51c T C 11: 87,397,754 H201R probably benign Het
Rims2 A T 15: 39,517,869 probably null Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Rpl22l1 T G 3: 28,806,836 S67A possibly damaging Het
Rps10 A G 17: 27,630,480 S143P probably damaging Het
Rundc1 T C 11: 101,425,141 V13A probably benign Het
Sephs2 C A 7: 127,273,392 M176I probably benign Het
Serpina16 C T 12: 103,674,930 V179I probably benign Het
Serpini2 T A 3: 75,259,477 T158S probably damaging Het
Slc12a3 A G 8: 94,346,351 R701G probably damaging Het
Slc1a6 A G 10: 78,814,602 E558G probably damaging Het
Ssx2ip T C 3: 146,430,917 probably benign Het
Tbr1 A T 2: 61,806,002 I241F possibly damaging Het
Tgfa G C 6: 86,270,082 probably null Het
Tlr12 T A 4: 128,617,270 K396* probably null Het
Tmppe A G 9: 114,405,958 I442V probably benign Het
Tubb3 T C 8: 123,420,868 V180A probably damaging Het
Vmn1r222 A G 13: 23,232,731 V104A probably damaging Het
Vmn2r95 G T 17: 18,451,446 V482L possibly damaging Het
Zfp184 G T 13: 21,959,282 R386L possibly damaging Het
Zfp444 T A 7: 6,189,793 V270E probably damaging Het
Zfp985 A T 4: 147,582,981 Y102F probably damaging Het
Other mutations in Pigo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Pigo APN 4 43021767 missense possibly damaging 0.63
IGL02176:Pigo APN 4 43019352 missense probably benign 0.20
IGL03197:Pigo APN 4 43022103 missense possibly damaging 0.92
R0207:Pigo UTSW 4 43023824 splice site probably benign
R0464:Pigo UTSW 4 43019814 missense probably benign 0.02
R0891:Pigo UTSW 4 43020519 nonsense probably null
R1445:Pigo UTSW 4 43021460 missense probably benign
R1484:Pigo UTSW 4 43024779 missense probably damaging 0.99
R1547:Pigo UTSW 4 43020689 missense probably benign 0.01
R1624:Pigo UTSW 4 43024661 missense probably damaging 1.00
R1847:Pigo UTSW 4 43024710 nonsense probably null
R3110:Pigo UTSW 4 43021083 missense probably benign 0.00
R3111:Pigo UTSW 4 43021083 missense probably benign 0.00
R3112:Pigo UTSW 4 43021083 missense probably benign 0.00
R3824:Pigo UTSW 4 43020909 missense possibly damaging 0.95
R3850:Pigo UTSW 4 43025084 missense probably benign 0.01
R3980:Pigo UTSW 4 43019231 missense probably damaging 1.00
R3982:Pigo UTSW 4 43023482 missense probably benign 0.00
R4520:Pigo UTSW 4 43020301 missense probably benign 0.16
R5033:Pigo UTSW 4 43019412 missense probably null 1.00
R5240:Pigo UTSW 4 43020675 missense possibly damaging 0.95
R5390:Pigo UTSW 4 43019645 critical splice donor site probably null
R5468:Pigo UTSW 4 43024562 critical splice donor site probably null
R5775:Pigo UTSW 4 43023475 missense probably damaging 1.00
R5839:Pigo UTSW 4 43022104 missense probably damaging 1.00
R5924:Pigo UTSW 4 43023389 nonsense probably null
R6111:Pigo UTSW 4 43019724 missense probably benign 0.18
R6451:Pigo UTSW 4 43021412 missense probably benign
R6533:Pigo UTSW 4 43022697 missense probably benign 0.07
R6884:Pigo UTSW 4 43022627 missense possibly damaging 0.88
R7026:Pigo UTSW 4 43023380 nonsense probably null
R7591:Pigo UTSW 4 43025093 missense probably benign
R7876:Pigo UTSW 4 43020671 missense probably benign 0.00
Z1088:Pigo UTSW 4 43019409 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGAGCCTTGTAAATAAAAGC -3'
(R):5'- TTCTCTCTGGTCCGAATGGC -3'

Sequencing Primer
(F):5'- AGTAGCTGACCCTCCCAGTG -3'
(R):5'- TGGTCCGAATGGCAGGGG -3'
Posted On2016-06-06