Incidental Mutation 'R5054:Kazn'
ID 390696
Institutional Source Beutler Lab
Gene Symbol Kazn
Ensembl Gene ENSMUSG00000040606
Gene Name kazrin, periplakin interacting protein
Synonyms
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.217) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 142102390-142239401 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 142108646 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 573 (N573D)
Gene Model predicted gene model for transcript(s):
AlphaFold Q69ZS8
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135922
Predicted Effect unknown
Transcript: ENSMUST00000155023
AA Change: N573D
SMART Domains Protein: ENSMUSP00000116071
Gene: ENSMUSG00000040606
AA Change: N573D

DomainStartEndE-ValueType
coiled coil region 1 180 N/A INTRINSIC
low complexity region 299 306 N/A INTRINSIC
SAM 367 435 6.32e-6 SMART
SAM 444 512 4.17e-6 SMART
SAM 533 602 3.37e-1 SMART
Meta Mutation Damage Score 0.1773 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in desmosome assembly, cell adhesion, cytoskeletal organization, and epidermal differentiation. This protein co-localizes with desmoplakin and the cytolinker protein periplakin. In general, this protein localizes to the nucleus, desmosomes, cell membrane, and cortical actin-based structures. Some isoforms of this protein also associate with microtubules. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity has not been verified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile and grossly normal with no obvious defects in skin development or homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,689,501 Y257H probably damaging Het
Adam28 C T 14: 68,617,715 C659Y probably damaging Het
Adamtsl2 G A 2: 27,101,720 E627K probably damaging Het
Atad5 T A 11: 80,094,676 S196R probably benign Het
Bcam T A 7: 19,756,860 probably benign Het
Birc6 A G 17: 74,655,325 H3978R probably damaging Het
Btbd7 T C 12: 102,838,212 I190V probably benign Het
Ccdc8 T C 7: 16,995,045 V153A probably damaging Het
Cyp2a5 C G 7: 26,841,104 R68G probably damaging Het
Dock3 T C 9: 106,937,906 Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 E2794G possibly damaging Het
Dytn C A 1: 63,661,159 V271L possibly damaging Het
Eif2s2 A C 2: 154,892,670 probably null Het
Fndc7 A G 3: 108,881,347 S193P probably damaging Het
Fzr1 G A 10: 81,371,419 probably benign Het
Gm17472 T C 6: 42,981,004 I69T probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gmppa C A 1: 75,439,371 Y137* probably null Het
Gpr45 A G 1: 43,032,649 I151V probably benign Het
H1f0 G A 15: 79,028,773 A18T probably damaging Het
Hbb-bh1 C T 7: 103,841,856 V114I probably benign Het
Impa2 C A 18: 67,306,727 P98Q probably damaging Het
Kcna2 A T 3: 107,104,340 D79V probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kif13a A G 13: 46,802,646 Y561H probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra1 T A 6: 130,375,284 Q165L probably damaging Het
Mat2b T A 11: 40,680,042 R318S probably damaging Het
Mgat4d G A 8: 83,368,208 probably null Het
Mtor T A 4: 148,556,855 probably null Het
Nostrin A T 2: 69,175,713 Q247L possibly damaging Het
Obscn T C 11: 59,073,617 E3033G probably damaging Het
Pam C A 1: 97,821,917 D839Y probably damaging Het
Pds5a A G 5: 65,637,814 V693A probably damaging Het
Pigo A T 4: 43,021,337 L535Q probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptar1 G T 19: 23,694,365 R44L probably damaging Het
Rad51c T C 11: 87,397,754 H201R probably benign Het
Rims2 A T 15: 39,517,869 probably null Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Rpl22l1 T G 3: 28,806,836 S67A possibly damaging Het
Rps10 A G 17: 27,630,480 S143P probably damaging Het
Rundc1 T C 11: 101,425,141 V13A probably benign Het
Sephs2 C A 7: 127,273,392 M176I probably benign Het
Serpina16 C T 12: 103,674,930 V179I probably benign Het
Serpini2 T A 3: 75,259,477 T158S probably damaging Het
Slc12a3 A G 8: 94,346,351 R701G probably damaging Het
Slc1a6 A G 10: 78,814,602 E558G probably damaging Het
Ssx2ip T C 3: 146,430,917 probably benign Het
Tbr1 A T 2: 61,806,002 I241F possibly damaging Het
Tgfa G C 6: 86,270,082 probably null Het
Tlr12 T A 4: 128,617,270 K396* probably null Het
Tmppe A G 9: 114,405,958 I442V probably benign Het
Tubb3 T C 8: 123,420,868 V180A probably damaging Het
Vmn1r222 A G 13: 23,232,731 V104A probably damaging Het
Vmn2r95 G T 17: 18,451,446 V482L possibly damaging Het
Zfp184 G T 13: 21,959,282 R386L possibly damaging Het
Zfp444 T A 7: 6,189,793 V270E probably damaging Het
Zfp985 A T 4: 147,582,981 Y102F probably damaging Het
Other mutations in Kazn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Kazn APN 4 142159043 critical splice donor site probably null
IGL01959:Kazn APN 4 142150884 missense probably damaging 1.00
IGL02237:Kazn APN 4 142147099 missense probably benign 0.31
IGL02351:Kazn APN 4 142147016 critical splice donor site probably null
IGL02358:Kazn APN 4 142147016 critical splice donor site probably null
R1173:Kazn UTSW 4 142159038 splice site probably benign
R2206:Kazn UTSW 4 142118292 splice site probably null
R3406:Kazn UTSW 4 142239195 start gained probably benign
R4007:Kazn UTSW 4 142106892 missense unknown
R4050:Kazn UTSW 4 142106904 missense unknown
R4598:Kazn UTSW 4 142210092 missense possibly damaging 0.53
R4606:Kazn UTSW 4 142118288 splice site probably null
R4631:Kazn UTSW 4 142118160 unclassified probably benign
R4866:Kazn UTSW 4 142104905 missense unknown
R5050:Kazn UTSW 4 142118203 unclassified probably benign
R5052:Kazn UTSW 4 142118203 unclassified probably benign
R5758:Kazn UTSW 4 142141671 critical splice donor site probably null
R6152:Kazn UTSW 4 142109287 missense unknown
R6284:Kazn UTSW 4 142117197 missense probably benign 0.04
R7289:Kazn UTSW 4 142117175 missense
R7414:Kazn UTSW 4 142109338 missense
R7663:Kazn UTSW 4 142104898 missense
R7814:Kazn UTSW 4 142210170 missense unknown
R8031:Kazn UTSW 4 142154551 missense
R8184:Kazn UTSW 4 142118130 missense probably benign 0.04
R8315:Kazn UTSW 4 142141691 missense
R8779:Kazn UTSW 4 142154545 missense
R8990:Kazn UTSW 4 142141636 missense probably damaging 1.00
R9491:Kazn UTSW 4 142118125 missense
Z1177:Kazn UTSW 4 142154504 missense
Predicted Primers PCR Primer
(F):5'- AGTGCATATCATCTCTAGCTCAAGC -3'
(R):5'- GTGTCAGTGACATAAGACCCC -3'

Sequencing Primer
(F):5'- GCTCAAGCGACACCTCAC -3'
(R):5'- GTGTCAGTGACATAAGACCCCCTATG -3'
Posted On 2016-06-06