Incidental Mutation 'R5054:Kazn'
ID 390696
Institutional Source Beutler Lab
Gene Symbol Kazn
Ensembl Gene ENSMUSG00000040606
Gene Name kazrin, periplakin interacting protein
Synonyms 9030409G11Rik, 2310007B04Rik
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.174) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 141829701-142205056 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141835957 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 573 (N573D)
Gene Model predicted gene model for transcript(s):
AlphaFold Q69ZS8
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135922
Predicted Effect unknown
Transcript: ENSMUST00000155023
AA Change: N573D
SMART Domains Protein: ENSMUSP00000116071
Gene: ENSMUSG00000040606
AA Change: N573D

DomainStartEndE-ValueType
coiled coil region 1 180 N/A INTRINSIC
low complexity region 299 306 N/A INTRINSIC
SAM 367 435 6.32e-6 SMART
SAM 444 512 4.17e-6 SMART
SAM 533 602 3.37e-1 SMART
Meta Mutation Damage Score 0.1773 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in desmosome assembly, cell adhesion, cytoskeletal organization, and epidermal differentiation. This protein co-localizes with desmoplakin and the cytolinker protein periplakin. In general, this protein localizes to the nucleus, desmosomes, cell membrane, and cortical actin-based structures. Some isoforms of this protein also associate with microtubules. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity has not been verified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile and grossly normal with no obvious defects in skin development or homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,837,315 (GRCm39) Y257H probably damaging Het
Adam28 C T 14: 68,855,164 (GRCm39) C659Y probably damaging Het
Adamtsl2 G A 2: 26,991,732 (GRCm39) E627K probably damaging Het
Atad5 T A 11: 79,985,502 (GRCm39) S196R probably benign Het
Bcam T A 7: 19,490,785 (GRCm39) probably benign Het
Birc6 A G 17: 74,962,320 (GRCm39) H3978R probably damaging Het
Btbd7 T C 12: 102,804,471 (GRCm39) I190V probably benign Het
Ccdc8 T C 7: 16,728,970 (GRCm39) V153A probably damaging Het
Cyp2a5 C G 7: 26,540,529 (GRCm39) R68G probably damaging Het
Dock3 T C 9: 106,815,105 (GRCm39) Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 (GRCm39) E2794G possibly damaging Het
Dytn C A 1: 63,700,318 (GRCm39) V271L possibly damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif2s2 A C 2: 154,734,590 (GRCm39) probably null Het
Fndc7 A G 3: 108,788,663 (GRCm39) S193P probably damaging Het
Fzr1 G A 10: 81,207,253 (GRCm39) probably benign Het
Gm17472 T C 6: 42,957,938 (GRCm39) I69T probably damaging Het
Gmppa C A 1: 75,416,015 (GRCm39) Y137* probably null Het
Gpr45 A G 1: 43,071,809 (GRCm39) I151V probably benign Het
H1f0 G A 15: 78,912,973 (GRCm39) A18T probably damaging Het
Hbb-bh1 C T 7: 103,491,063 (GRCm39) V114I probably benign Het
Impa2 C A 18: 67,439,797 (GRCm39) P98Q probably damaging Het
Kcna2 A T 3: 107,011,656 (GRCm39) D79V probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kif13a A G 13: 46,956,122 (GRCm39) Y561H probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klra1 T A 6: 130,352,247 (GRCm39) Q165L probably damaging Het
Mat2b T A 11: 40,570,869 (GRCm39) R318S probably damaging Het
Mgat4d G A 8: 84,094,837 (GRCm39) probably null Het
Mtor T A 4: 148,641,312 (GRCm39) probably null Het
Nostrin A T 2: 69,006,057 (GRCm39) Q247L possibly damaging Het
Obi1 C T 14: 104,745,466 (GRCm39) G70E probably damaging Het
Obscn T C 11: 58,964,443 (GRCm39) E3033G probably damaging Het
Pam C A 1: 97,749,642 (GRCm39) D839Y probably damaging Het
Pds5a A G 5: 65,795,157 (GRCm39) V693A probably damaging Het
Pigo A T 4: 43,021,337 (GRCm39) L535Q probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Ptar1 G T 19: 23,671,729 (GRCm39) R44L probably damaging Het
Rad51c T C 11: 87,288,580 (GRCm39) H201R probably benign Het
Rims2 A T 15: 39,381,265 (GRCm39) probably null Het
Rpl22l1 T G 3: 28,860,985 (GRCm39) S67A possibly damaging Het
Rps10 A G 17: 27,849,454 (GRCm39) S143P probably damaging Het
Rundc1 T C 11: 101,315,967 (GRCm39) V13A probably benign Het
Sephs2 C A 7: 126,872,564 (GRCm39) M176I probably benign Het
Serpina16 C T 12: 103,641,189 (GRCm39) V179I probably benign Het
Serpini2 T A 3: 75,166,784 (GRCm39) T158S probably damaging Het
Slc12a3 A G 8: 95,072,979 (GRCm39) R701G probably damaging Het
Slc1a6 A G 10: 78,650,436 (GRCm39) E558G probably damaging Het
Ssx2ip T C 3: 146,136,672 (GRCm39) probably benign Het
Tbr1 A T 2: 61,636,346 (GRCm39) I241F possibly damaging Het
Tgfa G C 6: 86,247,064 (GRCm39) probably null Het
Tlr12 T A 4: 128,511,063 (GRCm39) K396* probably null Het
Tmppe A G 9: 114,235,026 (GRCm39) I442V probably benign Het
Tubb3 T C 8: 124,147,607 (GRCm39) V180A probably damaging Het
Vmn1r222 A G 13: 23,416,901 (GRCm39) V104A probably damaging Het
Vmn2r95 G T 17: 18,671,708 (GRCm39) V482L possibly damaging Het
Zfp184 G T 13: 22,143,452 (GRCm39) R386L possibly damaging Het
Zfp444 T A 7: 6,192,792 (GRCm39) V270E probably damaging Het
Zfp985 A T 4: 147,667,438 (GRCm39) Y102F probably damaging Het
Other mutations in Kazn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Kazn APN 4 141,886,354 (GRCm39) critical splice donor site probably null
IGL01959:Kazn APN 4 141,878,195 (GRCm39) missense probably damaging 1.00
IGL02237:Kazn APN 4 141,874,410 (GRCm39) missense probably benign 0.31
IGL02351:Kazn APN 4 141,874,327 (GRCm39) critical splice donor site probably null
IGL02358:Kazn APN 4 141,874,327 (GRCm39) critical splice donor site probably null
R1173:Kazn UTSW 4 141,886,349 (GRCm39) splice site probably benign
R2206:Kazn UTSW 4 141,845,603 (GRCm39) splice site probably null
R3406:Kazn UTSW 4 141,966,506 (GRCm39) start gained probably benign
R4007:Kazn UTSW 4 141,834,203 (GRCm39) missense unknown
R4050:Kazn UTSW 4 141,834,215 (GRCm39) missense unknown
R4598:Kazn UTSW 4 141,937,403 (GRCm39) missense possibly damaging 0.53
R4606:Kazn UTSW 4 141,845,599 (GRCm39) splice site probably null
R4631:Kazn UTSW 4 141,845,471 (GRCm39) unclassified probably benign
R4866:Kazn UTSW 4 141,832,216 (GRCm39) missense unknown
R5050:Kazn UTSW 4 141,845,514 (GRCm39) unclassified probably benign
R5052:Kazn UTSW 4 141,845,514 (GRCm39) unclassified probably benign
R5758:Kazn UTSW 4 141,868,982 (GRCm39) critical splice donor site probably null
R6152:Kazn UTSW 4 141,836,598 (GRCm39) missense unknown
R6284:Kazn UTSW 4 141,844,508 (GRCm39) missense probably benign 0.04
R7289:Kazn UTSW 4 141,844,486 (GRCm39) missense
R7414:Kazn UTSW 4 141,836,649 (GRCm39) missense
R7663:Kazn UTSW 4 141,832,209 (GRCm39) missense
R7814:Kazn UTSW 4 141,937,481 (GRCm39) missense unknown
R8031:Kazn UTSW 4 141,881,862 (GRCm39) missense
R8184:Kazn UTSW 4 141,845,441 (GRCm39) missense probably benign 0.04
R8315:Kazn UTSW 4 141,869,002 (GRCm39) missense
R8779:Kazn UTSW 4 141,881,856 (GRCm39) missense
R8990:Kazn UTSW 4 141,868,947 (GRCm39) missense probably damaging 1.00
R9491:Kazn UTSW 4 141,845,436 (GRCm39) missense
Z1177:Kazn UTSW 4 141,881,815 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGTGCATATCATCTCTAGCTCAAGC -3'
(R):5'- GTGTCAGTGACATAAGACCCC -3'

Sequencing Primer
(F):5'- GCTCAAGCGACACCTCAC -3'
(R):5'- GTGTCAGTGACATAAGACCCCCTATG -3'
Posted On 2016-06-06