Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Pds5a'

390698

Institutional Source

Beutler Lab

Gene Symbol

Pds5a

Ensembl Gene

ENSMUSG00000029202

Gene Name

PDS5 cohesin associated factor A

Synonyms

9030416H16Rik, E230024D05Rik

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65605721-65698273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65637814 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 693 (V693A)

Ref Sequence

ENSEMBL: ENSMUSP00000144171 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031104] [ENSMUST00000201948]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000031104
AA Change: V693A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000031104
Gene: ENSMUSG00000029202
AA Change: V693A

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	253	782	6e-30	SMART
low complexity region	934	946	N/A	INTRINSIC
low complexity region	1174	1190	N/A	INTRINSIC
low complexity region	1258	1276	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200766

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201046

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201109

Predicted Effect

probably damaging
Transcript: ENSMUST00000201948
AA Change: V693A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144171
Gene: ENSMUSG00000029202
AA Change: V693A

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	253	782	6e-30	SMART
low complexity region	934	946	N/A	INTRINSIC
low complexity region	1174	1190	N/A	INTRINSIC
low complexity region	1258	1276	N/A	INTRINSIC

Meta Mutation Damage Score

0.3618

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the cohesin complex and associates with chromatin through most of the cell cycle. The encoded protein may play a role in regulating sister chromatid cohesion during mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with respiratory distress, abnormal heart development, abnormal skeletal development, kidney agenesis, and delayed enteric nervous system development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Atad5	T	A	11: 80,094,676	S196R	probably benign	Het
Bcam	T	A	7: 19,756,860		probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dock3	T	C	9: 106,937,906	Y1254C	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
Gpr45	A	G	1: 43,032,649	I151V	probably benign	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Nostrin	A	T	2: 69,175,713	Q247L	possibly damaging	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pam	C	A	1: 97,821,917	D839Y	probably damaging	Het
Pigo	A	T	4: 43,021,337	L535Q	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rad51c	T	C	11: 87,397,754	H201R	probably benign	Het
Rims2	A	T	15: 39,517,869		probably null	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Serpini2	T	A	3: 75,259,477	T158S	probably damaging	Het
Slc12a3	A	G	8: 94,346,351	R701G	probably damaging	Het
Slc1a6	A	G	10: 78,814,602	E558G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tbr1	A	T	2: 61,806,002	I241F	possibly damaging	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Pds5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00589:Pds5a	APN	5	65656344	missense	probably damaging	1.00
IGL00979:Pds5a	APN	5	65631723	missense	probably benign	0.22
IGL01314:Pds5a	APN	5	65615294	missense	probably benign
IGL02449:Pds5a	APN	5	65619010	missense	probably damaging	1.00
IGL02539:Pds5a	APN	5	65666119	missense	probably damaging	1.00
IGL03395:Pds5a	APN	5	65652449	missense	possibly damaging	0.61
R0569:Pds5a	UTSW	5	65656401	missense	probably damaging	1.00
R0704:Pds5a	UTSW	5	65620585	missense	probably damaging	1.00
R1170:Pds5a	UTSW	5	65635302	splice site	probably benign
R1181:Pds5a	UTSW	5	65627202	splice site	probably null
R1193:Pds5a	UTSW	5	65637802	missense	probably damaging	1.00
R1537:Pds5a	UTSW	5	65647121	missense	probably benign	0.09
R1853:Pds5a	UTSW	5	65624029	missense	possibly damaging	0.56
R2016:Pds5a	UTSW	5	65648007	critical splice acceptor site	probably null
R2154:Pds5a	UTSW	5	65650498	missense	probably damaging	1.00
R2209:Pds5a	UTSW	5	65628014	nonsense	probably null
R2234:Pds5a	UTSW	5	65654098	missense	probably damaging	1.00
R2235:Pds5a	UTSW	5	65654098	missense	probably damaging	1.00
R2332:Pds5a	UTSW	5	65627079	splice site	probably null
R3114:Pds5a	UTSW	5	65618985	missense	probably damaging	1.00
R3417:Pds5a	UTSW	5	65637892	missense	probably damaging	0.99
R3820:Pds5a	UTSW	5	65654076	missense	possibly damaging	0.94
R4152:Pds5a	UTSW	5	65666171	nonsense	probably null
R4159:Pds5a	UTSW	5	65664496	missense	possibly damaging	0.75
R4160:Pds5a	UTSW	5	65664496	missense	possibly damaging	0.75
R4161:Pds5a	UTSW	5	65664496	missense	possibly damaging	0.75
R4230:Pds5a	UTSW	5	65629986	missense	possibly damaging	0.85
R4491:Pds5a	UTSW	5	65635437	missense	probably benign
R4647:Pds5a	UTSW	5	65656318	missense	probably damaging	1.00
R4816:Pds5a	UTSW	5	65651289	missense	probably damaging	1.00
R4867:Pds5a	UTSW	5	65644120	missense	probably damaging	1.00
R5001:Pds5a	UTSW	5	65696785	missense	probably damaging	0.99
R5013:Pds5a	UTSW	5	65635337	missense	probably benign	0.05
R5068:Pds5a	UTSW	5	65615272	missense	probably damaging	0.99
R5178:Pds5a	UTSW	5	65663875	missense	probably damaging	1.00
R5269:Pds5a	UTSW	5	65663928	missense	probably damaging	1.00
R5396:Pds5a	UTSW	5	65638577	missense	probably benign	0.09
R5704:Pds5a	UTSW	5	65627079	splice site	probably null
R5940:Pds5a	UTSW	5	65643985	intron	probably benign
R6306:Pds5a	UTSW	5	65656296	missense	probably damaging	1.00
R6322:Pds5a	UTSW	5	65696834	missense	probably benign	0.00
R6467:Pds5a	UTSW	5	65652439	missense	probably damaging	1.00
R6476:Pds5a	UTSW	5	65634287	missense	possibly damaging	0.94
R6513:Pds5a	UTSW	5	65615601	missense	probably benign	0.18
R7304:Pds5a	UTSW	5	65619734	missense	probably damaging	1.00
R7312:Pds5a	UTSW	5	65666227	missense	possibly damaging	0.81
R7438:Pds5a	UTSW	5	65652535	critical splice acceptor site	probably null
R7637:Pds5a	UTSW	5	65638604	missense	probably benign	0.12
R7654:Pds5a	UTSW	5	65618981	missense	probably damaging	1.00
R7707:Pds5a	UTSW	5	65610133	missense	unknown
R7715:Pds5a	UTSW	5	65638561	missense	possibly damaging	0.96
R7748:Pds5a	UTSW	5	65619666	missense	possibly damaging	0.93
R7910:Pds5a	UTSW	5	65638582	missense	possibly damaging	0.85
R8014:Pds5a	UTSW	5	65627739	missense	possibly damaging	0.56
R8023:Pds5a	UTSW	5	65637898	missense	probably damaging	1.00
R8070:Pds5a	UTSW	5	65652398	missense	possibly damaging	0.92
R8190:Pds5a	UTSW	5	65623998	missense	probably damaging	1.00
R8406:Pds5a	UTSW	5	65646338	missense	probably benign	0.02
R9074:Pds5a	UTSW	5	65647136	missense	possibly damaging	0.86
R9222:Pds5a	UTSW	5	65647938	missense	probably benign	0.42
R9390:Pds5a	UTSW	5	65666257	missense	probably benign	0.39
R9404:Pds5a	UTSW	5	65618964	missense	probably damaging	0.99
R9479:Pds5a	UTSW	5	65635404	missense	probably damaging	1.00
R9493:Pds5a	UTSW	5	65635404	missense	probably damaging	1.00
R9596:Pds5a	UTSW	5	65615487	missense	probably benign	0.01
R9681:Pds5a	UTSW	5	65651244	missense	probably damaging	1.00
R9688:Pds5a	UTSW	5	65654853	missense	probably benign	0.44
R9792:Pds5a	UTSW	5	65638646	missense	probably benign
Z1088:Pds5a	UTSW	5	65618986	missense	probably damaging	1.00
Z1176:Pds5a	UTSW	5	65659727	missense	possibly damaging	0.75
Z1177:Pds5a	UTSW	5	65651212	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TACAGTTGGTCCGACTGCATC -3'
(R):5'- TCCAAGTGTTACAGCTAGCG -3'

Sequencing Primer
(F):5'- GACTGCATCTATCCTACCTGTGATAG -3'
(R):5'- GCGTTTGCACACCAGAAGTTTAC -3'

Posted On

2016-06-06