Incidental Mutation 'R5054:Pds5a'
ID390698
Institutional Source Beutler Lab
Gene Symbol Pds5a
Ensembl Gene ENSMUSG00000029202
Gene NamePDS5 cohesin associated factor A
Synonyms9030416H16Rik, E230024D05Rik
MMRRC Submission 042644-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5054 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location65605721-65698273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65637814 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 693 (V693A)
Ref Sequence ENSEMBL: ENSMUSP00000144171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031104] [ENSMUST00000201948]
Predicted Effect probably damaging
Transcript: ENSMUST00000031104
AA Change: V693A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031104
Gene: ENSMUSG00000029202
AA Change: V693A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 253 782 6e-30 SMART
low complexity region 934 946 N/A INTRINSIC
low complexity region 1174 1190 N/A INTRINSIC
low complexity region 1258 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201109
Predicted Effect probably damaging
Transcript: ENSMUST00000201948
AA Change: V693A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144171
Gene: ENSMUSG00000029202
AA Change: V693A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 253 782 6e-30 SMART
low complexity region 934 946 N/A INTRINSIC
low complexity region 1174 1190 N/A INTRINSIC
low complexity region 1258 1276 N/A INTRINSIC
Meta Mutation Damage Score 0.3618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the cohesin complex and associates with chromatin through most of the cell cycle. The encoded protein may play a role in regulating sister chromatid cohesion during mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with respiratory distress, abnormal heart development, abnormal skeletal development, kidney agenesis, and delayed enteric nervous system development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,689,501 Y257H probably damaging Het
Adam28 C T 14: 68,617,715 C659Y probably damaging Het
Adamtsl2 G A 2: 27,101,720 E627K probably damaging Het
Atad5 T A 11: 80,094,676 S196R probably benign Het
Bcam T A 7: 19,756,860 probably benign Het
Birc6 A G 17: 74,655,325 H3978R probably damaging Het
Btbd7 T C 12: 102,838,212 I190V probably benign Het
Ccdc8 T C 7: 16,995,045 V153A probably damaging Het
Cyp2a5 C G 7: 26,841,104 R68G probably damaging Het
Dock3 T C 9: 106,937,906 Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 E2794G possibly damaging Het
Dytn C A 1: 63,661,159 V271L possibly damaging Het
Eif2s2 A C 2: 154,892,670 probably null Het
Fndc7 A G 3: 108,881,347 S193P probably damaging Het
Fzr1 G A 10: 81,371,419 probably benign Het
Gm17472 T C 6: 42,981,004 I69T probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gmppa C A 1: 75,439,371 Y137* probably null Het
Gpr45 A G 1: 43,032,649 I151V probably benign Het
H1f0 G A 15: 79,028,773 A18T probably damaging Het
Hbb-bh1 C T 7: 103,841,856 V114I probably benign Het
Impa2 C A 18: 67,306,727 P98Q probably damaging Het
Kazn T C 4: 142,108,646 N573D unknown Het
Kcna2 A T 3: 107,104,340 D79V probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kif13a A G 13: 46,802,646 Y561H probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra1 T A 6: 130,375,284 Q165L probably damaging Het
Mat2b T A 11: 40,680,042 R318S probably damaging Het
Mgat4d G A 8: 83,368,208 probably null Het
Mtor T A 4: 148,556,855 probably null Het
Nostrin A T 2: 69,175,713 Q247L possibly damaging Het
Obscn T C 11: 59,073,617 E3033G probably damaging Het
Pam C A 1: 97,821,917 D839Y probably damaging Het
Pigo A T 4: 43,021,337 L535Q probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptar1 G T 19: 23,694,365 R44L probably damaging Het
Rad51c T C 11: 87,397,754 H201R probably benign Het
Rims2 A T 15: 39,517,869 probably null Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Rpl22l1 T G 3: 28,806,836 S67A possibly damaging Het
Rps10 A G 17: 27,630,480 S143P probably damaging Het
Rundc1 T C 11: 101,425,141 V13A probably benign Het
Sephs2 C A 7: 127,273,392 M176I probably benign Het
Serpina16 C T 12: 103,674,930 V179I probably benign Het
Serpini2 T A 3: 75,259,477 T158S probably damaging Het
Slc12a3 A G 8: 94,346,351 R701G probably damaging Het
Slc1a6 A G 10: 78,814,602 E558G probably damaging Het
Ssx2ip T C 3: 146,430,917 probably benign Het
Tbr1 A T 2: 61,806,002 I241F possibly damaging Het
Tgfa G C 6: 86,270,082 probably null Het
Tlr12 T A 4: 128,617,270 K396* probably null Het
Tmppe A G 9: 114,405,958 I442V probably benign Het
Tubb3 T C 8: 123,420,868 V180A probably damaging Het
Vmn1r222 A G 13: 23,232,731 V104A probably damaging Het
Vmn2r95 G T 17: 18,451,446 V482L possibly damaging Het
Zfp184 G T 13: 21,959,282 R386L possibly damaging Het
Zfp444 T A 7: 6,189,793 V270E probably damaging Het
Zfp985 A T 4: 147,582,981 Y102F probably damaging Het
Other mutations in Pds5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Pds5a APN 5 65656344 missense probably damaging 1.00
IGL00979:Pds5a APN 5 65631723 missense probably benign 0.22
IGL01314:Pds5a APN 5 65615294 missense probably benign
IGL02449:Pds5a APN 5 65619010 missense probably damaging 1.00
IGL02539:Pds5a APN 5 65666119 missense probably damaging 1.00
IGL03395:Pds5a APN 5 65652449 missense possibly damaging 0.61
R0569:Pds5a UTSW 5 65656401 missense probably damaging 1.00
R0704:Pds5a UTSW 5 65620585 missense probably damaging 1.00
R1170:Pds5a UTSW 5 65635302 splice site probably benign
R1181:Pds5a UTSW 5 65627202 splice site probably null
R1193:Pds5a UTSW 5 65637802 missense probably damaging 1.00
R1537:Pds5a UTSW 5 65647121 missense probably benign 0.09
R1853:Pds5a UTSW 5 65624029 missense possibly damaging 0.56
R2016:Pds5a UTSW 5 65648007 critical splice acceptor site probably null
R2154:Pds5a UTSW 5 65650498 missense probably damaging 1.00
R2209:Pds5a UTSW 5 65628014 nonsense probably null
R2234:Pds5a UTSW 5 65654098 missense probably damaging 1.00
R2235:Pds5a UTSW 5 65654098 missense probably damaging 1.00
R2332:Pds5a UTSW 5 65627079 splice site probably null
R3114:Pds5a UTSW 5 65618985 missense probably damaging 1.00
R3417:Pds5a UTSW 5 65637892 missense probably damaging 0.99
R3820:Pds5a UTSW 5 65654076 missense possibly damaging 0.94
R4152:Pds5a UTSW 5 65666171 nonsense probably null
R4159:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4160:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4161:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4230:Pds5a UTSW 5 65629986 missense possibly damaging 0.85
R4491:Pds5a UTSW 5 65635437 missense probably benign
R4647:Pds5a UTSW 5 65656318 missense probably damaging 1.00
R4816:Pds5a UTSW 5 65651289 missense probably damaging 1.00
R4867:Pds5a UTSW 5 65644120 missense probably damaging 1.00
R5001:Pds5a UTSW 5 65696785 missense probably damaging 0.99
R5013:Pds5a UTSW 5 65635337 missense probably benign 0.05
R5068:Pds5a UTSW 5 65615272 missense probably damaging 0.99
R5178:Pds5a UTSW 5 65663875 missense probably damaging 1.00
R5269:Pds5a UTSW 5 65663928 missense probably damaging 1.00
R5396:Pds5a UTSW 5 65638577 missense probably benign 0.09
R5704:Pds5a UTSW 5 65627079 splice site probably null
R5940:Pds5a UTSW 5 65643985 intron probably benign
R6306:Pds5a UTSW 5 65656296 missense probably damaging 1.00
R6322:Pds5a UTSW 5 65696834 missense probably benign 0.00
R6467:Pds5a UTSW 5 65652439 missense probably damaging 1.00
R6476:Pds5a UTSW 5 65634287 missense possibly damaging 0.94
R6513:Pds5a UTSW 5 65615601 missense probably benign 0.18
R7304:Pds5a UTSW 5 65619734 missense probably damaging 1.00
R7312:Pds5a UTSW 5 65666227 missense possibly damaging 0.81
R7438:Pds5a UTSW 5 65652535 critical splice acceptor site probably null
R7637:Pds5a UTSW 5 65638604 missense probably benign 0.12
R7654:Pds5a UTSW 5 65618981 missense probably damaging 1.00
R7707:Pds5a UTSW 5 65610133 missense unknown
R7715:Pds5a UTSW 5 65638561 missense possibly damaging 0.96
R7748:Pds5a UTSW 5 65619666 missense possibly damaging 0.93
Z1088:Pds5a UTSW 5 65618986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGTTGGTCCGACTGCATC -3'
(R):5'- TCCAAGTGTTACAGCTAGCG -3'

Sequencing Primer
(F):5'- GACTGCATCTATCCTACCTGTGATAG -3'
(R):5'- GCGTTTGCACACCAGAAGTTTAC -3'
Posted On2016-06-06