Incidental Mutation 'R5054:Tgfa'
ID 390700
Institutional Source Beutler Lab
Gene Symbol Tgfa
Ensembl Gene ENSMUSG00000029999
Gene Name transforming growth factor alpha
Synonyms
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 86172205-86252701 bp(+) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) G to C at 86247064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032066] [ENSMUST00000192058]
AlphaFold P48030
Predicted Effect probably null
Transcript: ENSMUST00000032066
SMART Domains Protein: ENSMUSP00000032066
Gene: ENSMUSG00000029999

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 45 82 1.01e-1 SMART
transmembrane domain 98 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192058
SMART Domains Protein: ENSMUSP00000141395
Gene: ENSMUSG00000029999

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:4TGF|A 39 71 4e-17 PDB
SCOP:d1ioxa_ 42 71 8e-11 SMART
Blast:EGF 45 71 1e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194449
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: This gene encodes a member of the epidermal growth factor (EGF) family of proteins that regulate cellular proliferation. The encoded protein undergoes proteolytic processing to generate a soluble glycoprotein that is secreted by the cell. The secreted protein binds to the EGF receptors to initiate signaling events resulting in cellular proliferation, mucous production or inhibition of gastric acid secretion. The transgenic expression of the encoded protein in mice induces the development of cancers in various tissues such as liver, pancreas, skin and mammary glands. Mice lacking the encoded protein exhibit a wavy coat and curly whiskers phenotype as well as abnormalities in the eye. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutants have curly vibrissae, wavy hair with misaligned hair follicles, reduced body weight, and eye defects including open eyelids at birth, corneal scarring and microphthalmia. Some heterozygotes show mild forms of the eye abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,837,315 (GRCm39) Y257H probably damaging Het
Adam28 C T 14: 68,855,164 (GRCm39) C659Y probably damaging Het
Adamtsl2 G A 2: 26,991,732 (GRCm39) E627K probably damaging Het
Atad5 T A 11: 79,985,502 (GRCm39) S196R probably benign Het
Bcam T A 7: 19,490,785 (GRCm39) probably benign Het
Birc6 A G 17: 74,962,320 (GRCm39) H3978R probably damaging Het
Btbd7 T C 12: 102,804,471 (GRCm39) I190V probably benign Het
Ccdc8 T C 7: 16,728,970 (GRCm39) V153A probably damaging Het
Cyp2a5 C G 7: 26,540,529 (GRCm39) R68G probably damaging Het
Dock3 T C 9: 106,815,105 (GRCm39) Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 (GRCm39) E2794G possibly damaging Het
Dytn C A 1: 63,700,318 (GRCm39) V271L possibly damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif2s2 A C 2: 154,734,590 (GRCm39) probably null Het
Fndc7 A G 3: 108,788,663 (GRCm39) S193P probably damaging Het
Fzr1 G A 10: 81,207,253 (GRCm39) probably benign Het
Gm17472 T C 6: 42,957,938 (GRCm39) I69T probably damaging Het
Gmppa C A 1: 75,416,015 (GRCm39) Y137* probably null Het
Gpr45 A G 1: 43,071,809 (GRCm39) I151V probably benign Het
H1f0 G A 15: 78,912,973 (GRCm39) A18T probably damaging Het
Hbb-bh1 C T 7: 103,491,063 (GRCm39) V114I probably benign Het
Impa2 C A 18: 67,439,797 (GRCm39) P98Q probably damaging Het
Kazn T C 4: 141,835,957 (GRCm39) N573D unknown Het
Kcna2 A T 3: 107,011,656 (GRCm39) D79V probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kif13a A G 13: 46,956,122 (GRCm39) Y561H probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klra1 T A 6: 130,352,247 (GRCm39) Q165L probably damaging Het
Mat2b T A 11: 40,570,869 (GRCm39) R318S probably damaging Het
Mgat4d G A 8: 84,094,837 (GRCm39) probably null Het
Mtor T A 4: 148,641,312 (GRCm39) probably null Het
Nostrin A T 2: 69,006,057 (GRCm39) Q247L possibly damaging Het
Obi1 C T 14: 104,745,466 (GRCm39) G70E probably damaging Het
Obscn T C 11: 58,964,443 (GRCm39) E3033G probably damaging Het
Pam C A 1: 97,749,642 (GRCm39) D839Y probably damaging Het
Pds5a A G 5: 65,795,157 (GRCm39) V693A probably damaging Het
Pigo A T 4: 43,021,337 (GRCm39) L535Q probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Ptar1 G T 19: 23,671,729 (GRCm39) R44L probably damaging Het
Rad51c T C 11: 87,288,580 (GRCm39) H201R probably benign Het
Rims2 A T 15: 39,381,265 (GRCm39) probably null Het
Rpl22l1 T G 3: 28,860,985 (GRCm39) S67A possibly damaging Het
Rps10 A G 17: 27,849,454 (GRCm39) S143P probably damaging Het
Rundc1 T C 11: 101,315,967 (GRCm39) V13A probably benign Het
Sephs2 C A 7: 126,872,564 (GRCm39) M176I probably benign Het
Serpina16 C T 12: 103,641,189 (GRCm39) V179I probably benign Het
Serpini2 T A 3: 75,166,784 (GRCm39) T158S probably damaging Het
Slc12a3 A G 8: 95,072,979 (GRCm39) R701G probably damaging Het
Slc1a6 A G 10: 78,650,436 (GRCm39) E558G probably damaging Het
Ssx2ip T C 3: 146,136,672 (GRCm39) probably benign Het
Tbr1 A T 2: 61,636,346 (GRCm39) I241F possibly damaging Het
Tlr12 T A 4: 128,511,063 (GRCm39) K396* probably null Het
Tmppe A G 9: 114,235,026 (GRCm39) I442V probably benign Het
Tubb3 T C 8: 124,147,607 (GRCm39) V180A probably damaging Het
Vmn1r222 A G 13: 23,416,901 (GRCm39) V104A probably damaging Het
Vmn2r95 G T 17: 18,671,708 (GRCm39) V482L possibly damaging Het
Zfp184 G T 13: 22,143,452 (GRCm39) R386L possibly damaging Het
Zfp444 T A 7: 6,192,792 (GRCm39) V270E probably damaging Het
Zfp985 A T 4: 147,667,438 (GRCm39) Y102F probably damaging Het
Other mutations in Tgfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03179:Tgfa APN 6 86,248,403 (GRCm39) missense probably benign 0.01
R0745:Tgfa UTSW 6 86,248,417 (GRCm39) missense probably damaging 0.99
R1109:Tgfa UTSW 6 86,247,072 (GRCm39) intron probably benign
R7602:Tgfa UTSW 6 86,246,944 (GRCm39) missense probably damaging 1.00
R8916:Tgfa UTSW 6 86,248,436 (GRCm39) missense probably damaging 1.00
R9614:Tgfa UTSW 6 86,248,397 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATCCTTCCAACTCAGCCTTGG -3'
(R):5'- CCAGTATTCACACAGCTTGCC -3'

Sequencing Primer
(F):5'- TCCAACTCAGCCTTGGGTAAG -3'
(R):5'- ACAGCTTGCCTGACACTGTG -3'
Posted On 2016-06-06