Incidental Mutation 'R5054:Klk14'
ID 390706
Institutional Source Beutler Lab
Gene Symbol Klk14
Ensembl Gene ENSMUSG00000044737
Gene Name kallikrein related-peptidase 14
Synonyms
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 43690418-43695536 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43692077 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 51 (C51Y)
Ref Sequence ENSEMBL: ENSMUSP00000056935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056329]
AlphaFold Q8CGR5
Predicted Effect probably damaging
Transcript: ENSMUST00000056329
AA Change: C51Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056935
Gene: ENSMUSG00000044737
AA Change: C51Y

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 23 243 2.02e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205416
Meta Mutation Damage Score 0.7935 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that have diverse physiological functions such as regulation of blood pressure and desquamation. The encoded protein is a precursor that undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. The encoded enzyme was found to activate the complement pathway by cleavage of C3 to release C3a anaphylotoxin. This gene is one of the several glandular kallikrein genes located in a cluster on chromosome 7. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,689,501 Y257H probably damaging Het
Adam28 C T 14: 68,617,715 C659Y probably damaging Het
Adamtsl2 G A 2: 27,101,720 E627K probably damaging Het
Atad5 T A 11: 80,094,676 S196R probably benign Het
Bcam T A 7: 19,756,860 probably benign Het
Birc6 A G 17: 74,655,325 H3978R probably damaging Het
Btbd7 T C 12: 102,838,212 I190V probably benign Het
Ccdc8 T C 7: 16,995,045 V153A probably damaging Het
Cyp2a5 C G 7: 26,841,104 R68G probably damaging Het
Dock3 T C 9: 106,937,906 Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 E2794G possibly damaging Het
Dytn C A 1: 63,661,159 V271L possibly damaging Het
Eif2s2 A C 2: 154,892,670 probably null Het
Fndc7 A G 3: 108,881,347 S193P probably damaging Het
Fzr1 G A 10: 81,371,419 probably benign Het
Gm17472 T C 6: 42,981,004 I69T probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gmppa C A 1: 75,439,371 Y137* probably null Het
Gpr45 A G 1: 43,032,649 I151V probably benign Het
H1f0 G A 15: 79,028,773 A18T probably damaging Het
Hbb-bh1 C T 7: 103,841,856 V114I probably benign Het
Impa2 C A 18: 67,306,727 P98Q probably damaging Het
Kazn T C 4: 142,108,646 N573D unknown Het
Kcna2 A T 3: 107,104,340 D79V probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kif13a A G 13: 46,802,646 Y561H probably damaging Het
Klra1 T A 6: 130,375,284 Q165L probably damaging Het
Mat2b T A 11: 40,680,042 R318S probably damaging Het
Mgat4d G A 8: 83,368,208 probably null Het
Mtor T A 4: 148,556,855 probably null Het
Nostrin A T 2: 69,175,713 Q247L possibly damaging Het
Obscn T C 11: 59,073,617 E3033G probably damaging Het
Pam C A 1: 97,821,917 D839Y probably damaging Het
Pds5a A G 5: 65,637,814 V693A probably damaging Het
Pigo A T 4: 43,021,337 L535Q probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptar1 G T 19: 23,694,365 R44L probably damaging Het
Rad51c T C 11: 87,397,754 H201R probably benign Het
Rims2 A T 15: 39,517,869 probably null Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Rpl22l1 T G 3: 28,806,836 S67A possibly damaging Het
Rps10 A G 17: 27,630,480 S143P probably damaging Het
Rundc1 T C 11: 101,425,141 V13A probably benign Het
Sephs2 C A 7: 127,273,392 M176I probably benign Het
Serpina16 C T 12: 103,674,930 V179I probably benign Het
Serpini2 T A 3: 75,259,477 T158S probably damaging Het
Slc12a3 A G 8: 94,346,351 R701G probably damaging Het
Slc1a6 A G 10: 78,814,602 E558G probably damaging Het
Ssx2ip T C 3: 146,430,917 probably benign Het
Tbr1 A T 2: 61,806,002 I241F possibly damaging Het
Tgfa G C 6: 86,270,082 probably null Het
Tlr12 T A 4: 128,617,270 K396* probably null Het
Tmppe A G 9: 114,405,958 I442V probably benign Het
Tubb3 T C 8: 123,420,868 V180A probably damaging Het
Vmn1r222 A G 13: 23,232,731 V104A probably damaging Het
Vmn2r95 G T 17: 18,451,446 V482L possibly damaging Het
Zfp184 G T 13: 21,959,282 R386L possibly damaging Het
Zfp444 T A 7: 6,189,793 V270E probably damaging Het
Zfp985 A T 4: 147,582,981 Y102F probably damaging Het
Other mutations in Klk14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0309:Klk14 UTSW 7 43694345 missense probably benign 0.01
R0467:Klk14 UTSW 7 43694110 missense probably benign 0.33
R1432:Klk14 UTSW 7 43694918 missense probably damaging 1.00
R1575:Klk14 UTSW 7 43693953 critical splice acceptor site probably null
R2160:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2185:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2188:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2189:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2472:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2474:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2961:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2962:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2968:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3147:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3148:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3176:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3177:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3276:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3277:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3418:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3419:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3430:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3956:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4080:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4081:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4152:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4153:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4169:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4205:Klk14 UTSW 7 43694934 missense probably benign 0.00
R4284:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4285:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4287:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4356:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4359:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4379:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4380:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4381:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4611:Klk14 UTSW 7 43694357 missense probably damaging 1.00
R4684:Klk14 UTSW 7 43691968 missense probably benign
R4784:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4792:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4793:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4825:Klk14 UTSW 7 43692076 missense probably damaging 1.00
R4844:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4847:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4884:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4898:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4941:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4942:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4943:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4972:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4997:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5021:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5022:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5024:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5053:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5056:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5057:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5097:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5253:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5257:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5459:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5489:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5490:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5493:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5543:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R6823:Klk14 UTSW 7 43694456 nonsense probably null
R7960:Klk14 UTSW 7 43692043 missense probably damaging 1.00
R7993:Klk14 UTSW 7 43694943 missense probably benign 0.01
R8220:Klk14 UTSW 7 43694074 missense probably damaging 1.00
R8701:Klk14 UTSW 7 43694142 missense possibly damaging 0.49
R8880:Klk14 UTSW 7 43694035 missense probably damaging 0.99
X0064:Klk14 UTSW 7 43694110 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AAGATCTCTGTCTGCTGGGC -3'
(R):5'- GGCAAGGGTTCTACATACACTC -3'

Sequencing Primer
(F):5'- ATCTCTGTCTGCTGGGCATTGG -3'
(R):5'- TGAATTATGCCTCTCAGCCTAG -3'
Posted On 2016-06-06