Incidental Mutation 'R5054:Hbb-bh1'
ID 390708
Institutional Source Beutler Lab
Gene Symbol Hbb-bh1
Ensembl Gene ENSMUSG00000052217
Gene Name hemoglobin Z, beta-like embryonic chain
Synonyms beta Hl globin, betaH1
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103841637-103843164 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103841856 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 114 (V114I)
Ref Sequence ENSEMBL: ENSMUSP00000064865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063957] [ENSMUST00000106866]
AlphaFold P04444
Predicted Effect probably benign
Transcript: ENSMUST00000063957
AA Change: V114I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064865
Gene: ENSMUSG00000052217
AA Change: V114I

DomainStartEndE-ValueType
Pfam:Globin 8 112 4.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106866
SMART Domains Protein: ENSMUSP00000102479
Gene: ENSMUSG00000078621

DomainStartEndE-ValueType
Pfam:Globin 8 112 1.9e-25 PFAM
Meta Mutation Damage Score 0.1063 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The epsilon globin gene (HBE) is normally expressed in the embryonic yolk sac: two epsilon chains together with two zeta chains (an alpha-like globin) constitute the embryonic hemoglobin Hb Gower I; two epsilon chains together with two alpha chains form the embryonic Hb Gower II. Both of these embryonic hemoglobins are normally supplanted by fetal, and later, adult hemoglobin. The five beta-like globin genes are found within a 45 kb cluster on chromosome 11 in the following order: 5'-epsilon - G-gamma - A-gamma - delta - beta-3' [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with disruptions in this gene are grossly normal and viable through adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,689,501 Y257H probably damaging Het
Adam28 C T 14: 68,617,715 C659Y probably damaging Het
Adamtsl2 G A 2: 27,101,720 E627K probably damaging Het
Atad5 T A 11: 80,094,676 S196R probably benign Het
Bcam T A 7: 19,756,860 probably benign Het
Birc6 A G 17: 74,655,325 H3978R probably damaging Het
Btbd7 T C 12: 102,838,212 I190V probably benign Het
Ccdc8 T C 7: 16,995,045 V153A probably damaging Het
Cyp2a5 C G 7: 26,841,104 R68G probably damaging Het
Dock3 T C 9: 106,937,906 Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 E2794G possibly damaging Het
Dytn C A 1: 63,661,159 V271L possibly damaging Het
Eif2s2 A C 2: 154,892,670 probably null Het
Fndc7 A G 3: 108,881,347 S193P probably damaging Het
Fzr1 G A 10: 81,371,419 probably benign Het
Gm17472 T C 6: 42,981,004 I69T probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gmppa C A 1: 75,439,371 Y137* probably null Het
Gpr45 A G 1: 43,032,649 I151V probably benign Het
H1f0 G A 15: 79,028,773 A18T probably damaging Het
Impa2 C A 18: 67,306,727 P98Q probably damaging Het
Kazn T C 4: 142,108,646 N573D unknown Het
Kcna2 A T 3: 107,104,340 D79V probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kif13a A G 13: 46,802,646 Y561H probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra1 T A 6: 130,375,284 Q165L probably damaging Het
Mat2b T A 11: 40,680,042 R318S probably damaging Het
Mgat4d G A 8: 83,368,208 probably null Het
Mtor T A 4: 148,556,855 probably null Het
Nostrin A T 2: 69,175,713 Q247L possibly damaging Het
Obscn T C 11: 59,073,617 E3033G probably damaging Het
Pam C A 1: 97,821,917 D839Y probably damaging Het
Pds5a A G 5: 65,637,814 V693A probably damaging Het
Pigo A T 4: 43,021,337 L535Q probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptar1 G T 19: 23,694,365 R44L probably damaging Het
Rad51c T C 11: 87,397,754 H201R probably benign Het
Rims2 A T 15: 39,517,869 probably null Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Rpl22l1 T G 3: 28,806,836 S67A possibly damaging Het
Rps10 A G 17: 27,630,480 S143P probably damaging Het
Rundc1 T C 11: 101,425,141 V13A probably benign Het
Sephs2 C A 7: 127,273,392 M176I probably benign Het
Serpina16 C T 12: 103,674,930 V179I probably benign Het
Serpini2 T A 3: 75,259,477 T158S probably damaging Het
Slc12a3 A G 8: 94,346,351 R701G probably damaging Het
Slc1a6 A G 10: 78,814,602 E558G probably damaging Het
Ssx2ip T C 3: 146,430,917 probably benign Het
Tbr1 A T 2: 61,806,002 I241F possibly damaging Het
Tgfa G C 6: 86,270,082 probably null Het
Tlr12 T A 4: 128,617,270 K396* probably null Het
Tmppe A G 9: 114,405,958 I442V probably benign Het
Tubb3 T C 8: 123,420,868 V180A probably damaging Het
Vmn1r222 A G 13: 23,232,731 V104A probably damaging Het
Vmn2r95 G T 17: 18,451,446 V482L possibly damaging Het
Zfp184 G T 13: 21,959,282 R386L possibly damaging Het
Zfp444 T A 7: 6,189,793 V270E probably damaging Het
Zfp985 A T 4: 147,582,981 Y102F probably damaging Het
Other mutations in Hbb-bh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Hbb-bh1 APN 7 103841817 missense probably benign 0.03
IGL02229:Hbb-bh1 APN 7 103842825 missense possibly damaging 0.77
IGL02251:Hbb-bh1 APN 7 103842810 nonsense probably null
R2913:Hbb-bh1 UTSW 7 103843047 missense possibly damaging 0.86
R6515:Hbb-bh1 UTSW 7 103842767 missense probably damaging 0.99
R7286:Hbb-bh1 UTSW 7 103843031 missense probably damaging 0.98
R9484:Hbb-bh1 UTSW 7 103843032 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCCCCATGGACTCAAAGAGG -3'
(R):5'- TTGACCATTGATGAATGAGACAGG -3'

Sequencing Primer
(F):5'- GGCATCATAGACACATGGGATTGC -3'
(R):5'- CAGATATAGCCAGTTGAGTGGTGTAC -3'
Posted On 2016-06-06