Incidental Mutation 'R5054:Sephs2'
ID 390709
Institutional Source Beutler Lab
Gene Symbol Sephs2
Ensembl Gene ENSMUSG00000049091
Gene Name selenophosphate synthetase 2
Synonyms Sps2, Ysg3
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.794) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 127271879-127274055 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 127273392 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 176 (M176I)
Ref Sequence ENSEMBL: ENSMUSP00000081009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082428]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082428
AA Change: M176I

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000081009
Gene: ENSMUSG00000049091
AA Change: M176I

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
Pfam:AIRS 118 234 1e-10 PFAM
Pfam:AIRS_C 246 421 2.3e-30 PFAM
low complexity region 433 452 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206759
Meta Mutation Damage Score 0.3046 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: This gene encodes an enzyme that synthesizes selenophosphate from selenide and ATP. Selenophosphate is the selenium donor used to synthesize selenocysteine (Sec) that is co-translationally incorporated into selenoproteins at in-frame UGA codons, which normally signal translation termination. This protein itself contains a Sec residue in its predicted active site. The 3' UTR of this gene has a stem-loop secondary structure called a selenocysteine insertion sequence (SECIS) element, which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,689,501 Y257H probably damaging Het
Adam28 C T 14: 68,617,715 C659Y probably damaging Het
Adamtsl2 G A 2: 27,101,720 E627K probably damaging Het
Atad5 T A 11: 80,094,676 S196R probably benign Het
Bcam T A 7: 19,756,860 probably benign Het
Birc6 A G 17: 74,655,325 H3978R probably damaging Het
Btbd7 T C 12: 102,838,212 I190V probably benign Het
Ccdc8 T C 7: 16,995,045 V153A probably damaging Het
Cyp2a5 C G 7: 26,841,104 R68G probably damaging Het
Dock3 T C 9: 106,937,906 Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 E2794G possibly damaging Het
Dytn C A 1: 63,661,159 V271L possibly damaging Het
Eif2s2 A C 2: 154,892,670 probably null Het
Fndc7 A G 3: 108,881,347 S193P probably damaging Het
Fzr1 G A 10: 81,371,419 probably benign Het
Gm17472 T C 6: 42,981,004 I69T probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gmppa C A 1: 75,439,371 Y137* probably null Het
Gpr45 A G 1: 43,032,649 I151V probably benign Het
H1f0 G A 15: 79,028,773 A18T probably damaging Het
Hbb-bh1 C T 7: 103,841,856 V114I probably benign Het
Impa2 C A 18: 67,306,727 P98Q probably damaging Het
Kazn T C 4: 142,108,646 N573D unknown Het
Kcna2 A T 3: 107,104,340 D79V probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kif13a A G 13: 46,802,646 Y561H probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra1 T A 6: 130,375,284 Q165L probably damaging Het
Mat2b T A 11: 40,680,042 R318S probably damaging Het
Mgat4d G A 8: 83,368,208 probably null Het
Mtor T A 4: 148,556,855 probably null Het
Nostrin A T 2: 69,175,713 Q247L possibly damaging Het
Obscn T C 11: 59,073,617 E3033G probably damaging Het
Pam C A 1: 97,821,917 D839Y probably damaging Het
Pds5a A G 5: 65,637,814 V693A probably damaging Het
Pigo A T 4: 43,021,337 L535Q probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptar1 G T 19: 23,694,365 R44L probably damaging Het
Rad51c T C 11: 87,397,754 H201R probably benign Het
Rims2 A T 15: 39,517,869 probably null Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Rpl22l1 T G 3: 28,806,836 S67A possibly damaging Het
Rps10 A G 17: 27,630,480 S143P probably damaging Het
Rundc1 T C 11: 101,425,141 V13A probably benign Het
Serpina16 C T 12: 103,674,930 V179I probably benign Het
Serpini2 T A 3: 75,259,477 T158S probably damaging Het
Slc12a3 A G 8: 94,346,351 R701G probably damaging Het
Slc1a6 A G 10: 78,814,602 E558G probably damaging Het
Ssx2ip T C 3: 146,430,917 probably benign Het
Tbr1 A T 2: 61,806,002 I241F possibly damaging Het
Tgfa G C 6: 86,270,082 probably null Het
Tlr12 T A 4: 128,617,270 K396* probably null Het
Tmppe A G 9: 114,405,958 I442V probably benign Het
Tubb3 T C 8: 123,420,868 V180A probably damaging Het
Vmn1r222 A G 13: 23,232,731 V104A probably damaging Het
Vmn2r95 G T 17: 18,451,446 V482L possibly damaging Het
Zfp184 G T 13: 21,959,282 R386L possibly damaging Het
Zfp444 T A 7: 6,189,793 V270E probably damaging Het
Zfp985 A T 4: 147,582,981 Y102F probably damaging Het
Other mutations in Sephs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Sephs2 APN 7 127273087 missense probably benign 0.43
IGL03006:Sephs2 APN 7 127273034 missense probably benign
IGL03295:Sephs2 APN 7 127272769 missense possibly damaging 0.60
R1381:Sephs2 UTSW 7 127272967 missense probably damaging 1.00
R2259:Sephs2 UTSW 7 127273477 missense possibly damaging 0.80
R4876:Sephs2 UTSW 7 127273047 nonsense probably null
R5432:Sephs2 UTSW 7 127273805 missense probably damaging 1.00
R6197:Sephs2 UTSW 7 127272901 missense probably damaging 1.00
R6237:Sephs2 UTSW 7 127273946 start gained probably benign
R7138:Sephs2 UTSW 7 127273015 missense possibly damaging 0.96
R7181:Sephs2 UTSW 7 127273820 missense probably benign
R7601:Sephs2 UTSW 7 127272946 missense probably damaging 1.00
R7685:Sephs2 UTSW 7 127273334 missense possibly damaging 0.46
R8941:Sephs2 UTSW 7 127273034 missense probably benign
R9263:Sephs2 UTSW 7 127272950 missense probably damaging 1.00
R9526:Sephs2 UTSW 7 127273174 missense probably damaging 1.00
X0061:Sephs2 UTSW 7 127273555 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GGTTAATACCAGCACATCTCCTACC -3'
(R):5'- TGAGCATTGGCATGGACTC -3'

Sequencing Primer
(F):5'- ACGGCACTATCAGGCATTATG -3'
(R):5'- ATTGGCATGGACTCCTGCG -3'
Posted On 2016-06-06