Incidental Mutation 'R5054:Mgat4d'
ID 390710
Institutional Source Beutler Lab
Gene Symbol Mgat4d
Ensembl Gene ENSMUSG00000035057
Gene Name MGAT4 family, member C
Synonyms 4933434I20Rik
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 84075101-84106031 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 84094837 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038692]
AlphaFold Q9D4R2
Predicted Effect probably null
Transcript: ENSMUST00000038692
SMART Domains Protein: ENSMUSP00000041629
Gene: ENSMUSG00000035057

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_54 70 373 5.9e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139692
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,837,315 (GRCm39) Y257H probably damaging Het
Adam28 C T 14: 68,855,164 (GRCm39) C659Y probably damaging Het
Adamtsl2 G A 2: 26,991,732 (GRCm39) E627K probably damaging Het
Atad5 T A 11: 79,985,502 (GRCm39) S196R probably benign Het
Bcam T A 7: 19,490,785 (GRCm39) probably benign Het
Birc6 A G 17: 74,962,320 (GRCm39) H3978R probably damaging Het
Btbd7 T C 12: 102,804,471 (GRCm39) I190V probably benign Het
Ccdc8 T C 7: 16,728,970 (GRCm39) V153A probably damaging Het
Cyp2a5 C G 7: 26,540,529 (GRCm39) R68G probably damaging Het
Dock3 T C 9: 106,815,105 (GRCm39) Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 (GRCm39) E2794G possibly damaging Het
Dytn C A 1: 63,700,318 (GRCm39) V271L possibly damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif2s2 A C 2: 154,734,590 (GRCm39) probably null Het
Fndc7 A G 3: 108,788,663 (GRCm39) S193P probably damaging Het
Fzr1 G A 10: 81,207,253 (GRCm39) probably benign Het
Gm17472 T C 6: 42,957,938 (GRCm39) I69T probably damaging Het
Gmppa C A 1: 75,416,015 (GRCm39) Y137* probably null Het
Gpr45 A G 1: 43,071,809 (GRCm39) I151V probably benign Het
H1f0 G A 15: 78,912,973 (GRCm39) A18T probably damaging Het
Hbb-bh1 C T 7: 103,491,063 (GRCm39) V114I probably benign Het
Impa2 C A 18: 67,439,797 (GRCm39) P98Q probably damaging Het
Kazn T C 4: 141,835,957 (GRCm39) N573D unknown Het
Kcna2 A T 3: 107,011,656 (GRCm39) D79V probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kif13a A G 13: 46,956,122 (GRCm39) Y561H probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klra1 T A 6: 130,352,247 (GRCm39) Q165L probably damaging Het
Mat2b T A 11: 40,570,869 (GRCm39) R318S probably damaging Het
Mtor T A 4: 148,641,312 (GRCm39) probably null Het
Nostrin A T 2: 69,006,057 (GRCm39) Q247L possibly damaging Het
Obi1 C T 14: 104,745,466 (GRCm39) G70E probably damaging Het
Obscn T C 11: 58,964,443 (GRCm39) E3033G probably damaging Het
Pam C A 1: 97,749,642 (GRCm39) D839Y probably damaging Het
Pds5a A G 5: 65,795,157 (GRCm39) V693A probably damaging Het
Pigo A T 4: 43,021,337 (GRCm39) L535Q probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Ptar1 G T 19: 23,671,729 (GRCm39) R44L probably damaging Het
Rad51c T C 11: 87,288,580 (GRCm39) H201R probably benign Het
Rims2 A T 15: 39,381,265 (GRCm39) probably null Het
Rpl22l1 T G 3: 28,860,985 (GRCm39) S67A possibly damaging Het
Rps10 A G 17: 27,849,454 (GRCm39) S143P probably damaging Het
Rundc1 T C 11: 101,315,967 (GRCm39) V13A probably benign Het
Sephs2 C A 7: 126,872,564 (GRCm39) M176I probably benign Het
Serpina16 C T 12: 103,641,189 (GRCm39) V179I probably benign Het
Serpini2 T A 3: 75,166,784 (GRCm39) T158S probably damaging Het
Slc12a3 A G 8: 95,072,979 (GRCm39) R701G probably damaging Het
Slc1a6 A G 10: 78,650,436 (GRCm39) E558G probably damaging Het
Ssx2ip T C 3: 146,136,672 (GRCm39) probably benign Het
Tbr1 A T 2: 61,636,346 (GRCm39) I241F possibly damaging Het
Tgfa G C 6: 86,247,064 (GRCm39) probably null Het
Tlr12 T A 4: 128,511,063 (GRCm39) K396* probably null Het
Tmppe A G 9: 114,235,026 (GRCm39) I442V probably benign Het
Tubb3 T C 8: 124,147,607 (GRCm39) V180A probably damaging Het
Vmn1r222 A G 13: 23,416,901 (GRCm39) V104A probably damaging Het
Vmn2r95 G T 17: 18,671,708 (GRCm39) V482L possibly damaging Het
Zfp184 G T 13: 22,143,452 (GRCm39) R386L possibly damaging Het
Zfp444 T A 7: 6,192,792 (GRCm39) V270E probably damaging Het
Zfp985 A T 4: 147,667,438 (GRCm39) Y102F probably damaging Het
Other mutations in Mgat4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Mgat4d APN 8 84,081,425 (GRCm39) missense probably benign 0.21
IGL01634:Mgat4d APN 8 84,094,745 (GRCm39) missense possibly damaging 0.71
IGL01987:Mgat4d APN 8 84,094,731 (GRCm39) missense probably damaging 1.00
IGL02084:Mgat4d APN 8 84,095,610 (GRCm39) missense possibly damaging 0.72
R0546:Mgat4d UTSW 8 84,082,350 (GRCm39) missense possibly damaging 0.94
R1322:Mgat4d UTSW 8 84,092,354 (GRCm39) missense possibly damaging 0.74
R1526:Mgat4d UTSW 8 84,095,666 (GRCm39) missense probably benign 0.25
R1617:Mgat4d UTSW 8 84,092,340 (GRCm39) missense probably damaging 1.00
R2223:Mgat4d UTSW 8 84,082,301 (GRCm39) splice site probably benign
R3157:Mgat4d UTSW 8 84,081,450 (GRCm39) missense probably benign
R3421:Mgat4d UTSW 8 84,084,772 (GRCm39) missense probably damaging 1.00
R3422:Mgat4d UTSW 8 84,084,772 (GRCm39) missense probably damaging 1.00
R4387:Mgat4d UTSW 8 84,098,335 (GRCm39) missense probably damaging 1.00
R4796:Mgat4d UTSW 8 84,084,749 (GRCm39) missense probably damaging 1.00
R4805:Mgat4d UTSW 8 84,084,787 (GRCm39) splice site probably null
R6366:Mgat4d UTSW 8 84,095,580 (GRCm39) splice site probably null
R6927:Mgat4d UTSW 8 84,081,496 (GRCm39) missense probably benign 0.03
R7053:Mgat4d UTSW 8 84,098,261 (GRCm39) missense probably damaging 0.98
R7554:Mgat4d UTSW 8 84,082,402 (GRCm39) missense probably benign 0.00
R7566:Mgat4d UTSW 8 84,084,652 (GRCm39) missense probably damaging 1.00
R7965:Mgat4d UTSW 8 84,084,722 (GRCm39) missense possibly damaging 0.95
R8111:Mgat4d UTSW 8 84,094,776 (GRCm39) missense probably damaging 0.96
R8344:Mgat4d UTSW 8 84,094,762 (GRCm39) missense probably benign 0.01
Z1176:Mgat4d UTSW 8 84,094,741 (GRCm39) missense probably benign 0.39
Z1176:Mgat4d UTSW 8 84,075,150 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCCAAAGTACTGTTTGTCTTTGAG -3'
(R):5'- CATACTCATAGCGCCCAATTTTATG -3'

Sequencing Primer
(F):5'- CTCTAGCTAGAAGATGATATCGTA -3'
(R):5'- GGTGGCATGCACCTATAATCCTAG -3'
Posted On 2016-06-06