Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Slc12a3'

390711

Institutional Source

Beutler Lab

Gene Symbol

Slc12a3

Ensembl Gene

ENSMUSG00000031766

Gene Name

solute carrier family 12, member 3

Synonyms

NCC, TSC

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94329201-94366214 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94346351 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 701 (R701G)

Ref Sequence

ENSEMBL: ENSMUSP00000148455 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034218] [ENSMUST00000212134]

AlphaFold

P59158

Predicted Effect

probably damaging
Transcript: ENSMUST00000034218
AA Change: R701G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000034218
Gene: ENSMUSG00000031766
AA Change: R701G

Domain	Start	End	E-Value	Type
Pfam:AA_permease_N	43	114	1.5e-30	PFAM
Pfam:AA_permease	139	645	3.6e-145	PFAM
Pfam:SLC12	653	801	1.4e-53	PFAM
Pfam:SLC12	787	1001	2e-85	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212041

Predicted Effect

probably damaging
Transcript: ENSMUST00000212134
AA Change: R701G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212915

Meta Mutation Damage Score

0.3634

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a renal thiazide-sensitive sodium-chloride cotransporter that is important for electrolyte homeostasis. This cotransporter mediates sodium and chloride reabsorption in the distal convoluted tubule. Mutations in this gene cause Gitelman syndrome, a disease similar to Bartter's syndrome, that is characterized by hypokalemic alkalosis combined with hypomagnesemia, low urinary calcium, and increased renin activity associated with normal blood pressure. This cotransporter is the target for thiazide diuretics that are used for treating high blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomagnesemia, hypocalciurua and abnormal renal distal convoluted tubule morphology, and show significantly reduced arterial blood pressure on a sodium-depleted diet. Mutant kidney cortical collecting ductsdisplay thiazide-sensitive NaCl absorption. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Atad5	T	A	11: 80,094,676	S196R	probably benign	Het
Bcam	T	A	7: 19,756,860		probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dock3	T	C	9: 106,937,906	Y1254C	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
Gpr45	A	G	1: 43,032,649	I151V	probably benign	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Nostrin	A	T	2: 69,175,713	Q247L	possibly damaging	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pam	C	A	1: 97,821,917	D839Y	probably damaging	Het
Pds5a	A	G	5: 65,637,814	V693A	probably damaging	Het
Pigo	A	T	4: 43,021,337	L535Q	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rad51c	T	C	11: 87,397,754	H201R	probably benign	Het
Rims2	A	T	15: 39,517,869		probably null	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Serpini2	T	A	3: 75,259,477	T158S	probably damaging	Het
Slc1a6	A	G	10: 78,814,602	E558G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tbr1	A	T	2: 61,806,002	I241F	possibly damaging	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Slc12a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01823:Slc12a3	APN	8	94357096	missense	probably benign	0.00
IGL01947:Slc12a3	APN	8	94365819	critical splice acceptor site	probably null
IGL02151:Slc12a3	APN	8	94348592	missense	probably benign	0.26
IGL02440:Slc12a3	APN	8	94331682	missense	probably damaging	1.00
IGL03213:Slc12a3	APN	8	94335305	missense	possibly damaging	0.95
IGL03260:Slc12a3	APN	8	94333242	missense	probably damaging	1.00
IGL03306:Slc12a3	APN	8	94351758	missense	possibly damaging	0.72
IGL03329:Slc12a3	APN	8	94365891	missense	possibly damaging	0.67
avaricious	UTSW	8	94330472	missense	probably benign	0.01
Pugilist	UTSW	8	94345773	critical splice acceptor site	probably null
R0131:Slc12a3	UTSW	8	94340883	splice site	probably benign
R0189:Slc12a3	UTSW	8	94356358	missense	probably benign	0.30
R0330:Slc12a3	UTSW	8	94346346	missense	possibly damaging	0.75
R0569:Slc12a3	UTSW	8	94330525	critical splice donor site	probably null
R0715:Slc12a3	UTSW	8	94329433	missense	possibly damaging	0.75
R1248:Slc12a3	UTSW	8	94333277	missense	probably damaging	1.00
R1565:Slc12a3	UTSW	8	94345877	missense	possibly damaging	0.75
R2068:Slc12a3	UTSW	8	94345828	missense	probably damaging	1.00
R2108:Slc12a3	UTSW	8	94340530	missense	probably damaging	0.97
R2273:Slc12a3	UTSW	8	94333287	missense	possibly damaging	0.86
R2274:Slc12a3	UTSW	8	94333287	missense	possibly damaging	0.86
R2275:Slc12a3	UTSW	8	94333287	missense	possibly damaging	0.86
R2433:Slc12a3	UTSW	8	94346316	missense	probably benign	0.00
R3770:Slc12a3	UTSW	8	94353040	missense	probably benign
R4429:Slc12a3	UTSW	8	94343085	missense	probably damaging	1.00
R4431:Slc12a3	UTSW	8	94343085	missense	probably damaging	1.00
R4533:Slc12a3	UTSW	8	94357086	missense	probably null	0.02
R4627:Slc12a3	UTSW	8	94329384	missense	probably benign
R4856:Slc12a3	UTSW	8	94351810	critical splice donor site	probably null
R4886:Slc12a3	UTSW	8	94351810	critical splice donor site	probably null
R4908:Slc12a3	UTSW	8	94348588	missense	possibly damaging	0.76
R5299:Slc12a3	UTSW	8	94351789	missense	probably damaging	1.00
R5451:Slc12a3	UTSW	8	94357027	missense	possibly damaging	0.61
R5590:Slc12a3	UTSW	8	94345788	missense	probably damaging	1.00
R5725:Slc12a3	UTSW	8	94330446	missense	probably benign	0.00
R6038:Slc12a3	UTSW	8	94330472	missense	probably benign	0.01
R6038:Slc12a3	UTSW	8	94330472	missense	probably benign	0.01
R6162:Slc12a3	UTSW	8	94345773	critical splice acceptor site	probably null
R6266:Slc12a3	UTSW	8	94358471	missense	possibly damaging	0.93
R6489:Slc12a3	UTSW	8	94335004	missense	possibly damaging	0.96
R6521:Slc12a3	UTSW	8	94343113	missense	possibly damaging	0.84
R6882:Slc12a3	UTSW	8	94365918	missense	possibly damaging	0.51
R7051:Slc12a3	UTSW	8	94365944	missense	probably damaging	1.00
R7510:Slc12a3	UTSW	8	94365849	missense	probably damaging	1.00
R7805:Slc12a3	UTSW	8	94344887	missense	probably damaging	1.00
R8152:Slc12a3	UTSW	8	94330384	missense	probably benign	0.00
R8412:Slc12a3	UTSW	8	94334067	missense	probably damaging	0.99
R8996:Slc12a3	UTSW	8	94329435	missense	probably benign
R9307:Slc12a3	UTSW	8	94334997	missense	probably benign	0.01
R9324:Slc12a3	UTSW	8	94356400	critical splice donor site	probably null
R9515:Slc12a3	UTSW	8	94357030	missense	possibly damaging	0.79
R9564:Slc12a3	UTSW	8	94356355	missense	probably benign	0.00
R9687:Slc12a3	UTSW	8	94348580	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- GTGGACCTAGCAGAATCTGG -3'
(R):5'- ACATAGGCAAGTGGGGATCC -3'

Sequencing Primer
(F):5'- GTAGCTGAGGTTGACCCTACATC -3'
(R):5'- CCGCTGCAGCCACCTAAG -3'

Posted On

2016-06-06