Incidental Mutation 'R5054:Dock3'
ID 390714
Institutional Source Beutler Lab
Gene Symbol Dock3
Ensembl Gene ENSMUSG00000039716
Gene Name dedicator of cyto-kinesis 3
Synonyms Moca, PBP
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.616) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 106770024-107109108 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106815105 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1254 (Y1254C)
Ref Sequence ENSEMBL: ENSMUSP00000047652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044532]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044532
AA Change: Y1254C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047652
Gene: ENSMUSG00000039716
AA Change: Y1254C

DomainStartEndE-ValueType
SH3 9 66 3.85e-9 SMART
Pfam:DOCK_N 69 412 1.4e-120 PFAM
Pfam:DOCK-C2 417 608 7.7e-56 PFAM
low complexity region 854 867 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
Pfam:DHR-2 1121 1628 9e-133 PFAM
low complexity region 1679 1690 N/A INTRINSIC
low complexity region 1693 1704 N/A INTRINSIC
low complexity region 1730 1754 N/A INTRINSIC
low complexity region 1880 1902 N/A INTRINSIC
low complexity region 1963 1977 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000168759
AA Change: Y120C
SMART Domains Protein: ENSMUSP00000131410
Gene: ENSMUSG00000039716
AA Change: Y120C

DomainStartEndE-ValueType
Pfam:DHR-2 1 241 4e-48 PFAM
Meta Mutation Damage Score 0.6289 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the central nervous system (CNS). It encodes a member of the DOCK (dedicator of cytokinesis) family of guanine nucleotide exchange factors (GEFs). This protein, dedicator of cytokinesis 3 (DOCK3), is also known as modifier of cell adhesion (MOCA) and presenilin-binding protein (PBP). The DOCK3 and DOCK1, -2 and -4 share several conserved amino acids in their DHR-2 (DOCK homology region 2) domains that are required for GEF activity, and bind directly to WAVE proteins [Wiskott-Aldrich syndrome protein (WASP) family Verprolin-homologous proteins] via their DHR-1 domains. The DOCK3 induces axonal outgrowth in CNS by stimulating membrane recruitment of the WAVE complex and activating the small G protein Rac1. This gene is associated with an attention deficit hyperactivity disorder-like phenotype by a complex chromosomal rearrangement. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors and muscular weakness associated with axonal dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,837,315 (GRCm39) Y257H probably damaging Het
Adam28 C T 14: 68,855,164 (GRCm39) C659Y probably damaging Het
Adamtsl2 G A 2: 26,991,732 (GRCm39) E627K probably damaging Het
Atad5 T A 11: 79,985,502 (GRCm39) S196R probably benign Het
Bcam T A 7: 19,490,785 (GRCm39) probably benign Het
Birc6 A G 17: 74,962,320 (GRCm39) H3978R probably damaging Het
Btbd7 T C 12: 102,804,471 (GRCm39) I190V probably benign Het
Ccdc8 T C 7: 16,728,970 (GRCm39) V153A probably damaging Het
Cyp2a5 C G 7: 26,540,529 (GRCm39) R68G probably damaging Het
Dync2h1 T C 9: 7,085,007 (GRCm39) E2794G possibly damaging Het
Dytn C A 1: 63,700,318 (GRCm39) V271L possibly damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif2s2 A C 2: 154,734,590 (GRCm39) probably null Het
Fndc7 A G 3: 108,788,663 (GRCm39) S193P probably damaging Het
Fzr1 G A 10: 81,207,253 (GRCm39) probably benign Het
Gm17472 T C 6: 42,957,938 (GRCm39) I69T probably damaging Het
Gmppa C A 1: 75,416,015 (GRCm39) Y137* probably null Het
Gpr45 A G 1: 43,071,809 (GRCm39) I151V probably benign Het
H1f0 G A 15: 78,912,973 (GRCm39) A18T probably damaging Het
Hbb-bh1 C T 7: 103,491,063 (GRCm39) V114I probably benign Het
Impa2 C A 18: 67,439,797 (GRCm39) P98Q probably damaging Het
Kazn T C 4: 141,835,957 (GRCm39) N573D unknown Het
Kcna2 A T 3: 107,011,656 (GRCm39) D79V probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kif13a A G 13: 46,956,122 (GRCm39) Y561H probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klra1 T A 6: 130,352,247 (GRCm39) Q165L probably damaging Het
Mat2b T A 11: 40,570,869 (GRCm39) R318S probably damaging Het
Mgat4d G A 8: 84,094,837 (GRCm39) probably null Het
Mtor T A 4: 148,641,312 (GRCm39) probably null Het
Nostrin A T 2: 69,006,057 (GRCm39) Q247L possibly damaging Het
Obi1 C T 14: 104,745,466 (GRCm39) G70E probably damaging Het
Obscn T C 11: 58,964,443 (GRCm39) E3033G probably damaging Het
Pam C A 1: 97,749,642 (GRCm39) D839Y probably damaging Het
Pds5a A G 5: 65,795,157 (GRCm39) V693A probably damaging Het
Pigo A T 4: 43,021,337 (GRCm39) L535Q probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Ptar1 G T 19: 23,671,729 (GRCm39) R44L probably damaging Het
Rad51c T C 11: 87,288,580 (GRCm39) H201R probably benign Het
Rims2 A T 15: 39,381,265 (GRCm39) probably null Het
Rpl22l1 T G 3: 28,860,985 (GRCm39) S67A possibly damaging Het
Rps10 A G 17: 27,849,454 (GRCm39) S143P probably damaging Het
Rundc1 T C 11: 101,315,967 (GRCm39) V13A probably benign Het
Sephs2 C A 7: 126,872,564 (GRCm39) M176I probably benign Het
Serpina16 C T 12: 103,641,189 (GRCm39) V179I probably benign Het
Serpini2 T A 3: 75,166,784 (GRCm39) T158S probably damaging Het
Slc12a3 A G 8: 95,072,979 (GRCm39) R701G probably damaging Het
Slc1a6 A G 10: 78,650,436 (GRCm39) E558G probably damaging Het
Ssx2ip T C 3: 146,136,672 (GRCm39) probably benign Het
Tbr1 A T 2: 61,636,346 (GRCm39) I241F possibly damaging Het
Tgfa G C 6: 86,247,064 (GRCm39) probably null Het
Tlr12 T A 4: 128,511,063 (GRCm39) K396* probably null Het
Tmppe A G 9: 114,235,026 (GRCm39) I442V probably benign Het
Tubb3 T C 8: 124,147,607 (GRCm39) V180A probably damaging Het
Vmn1r222 A G 13: 23,416,901 (GRCm39) V104A probably damaging Het
Vmn2r95 G T 17: 18,671,708 (GRCm39) V482L possibly damaging Het
Zfp184 G T 13: 22,143,452 (GRCm39) R386L possibly damaging Het
Zfp444 T A 7: 6,192,792 (GRCm39) V270E probably damaging Het
Zfp985 A T 4: 147,667,438 (GRCm39) Y102F probably damaging Het
Other mutations in Dock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Dock3 APN 9 106,788,576 (GRCm39) splice site probably benign
IGL01067:Dock3 APN 9 106,959,572 (GRCm39) critical splice donor site probably null
IGL01160:Dock3 APN 9 106,783,887 (GRCm39) missense probably damaging 1.00
IGL01290:Dock3 APN 9 106,835,599 (GRCm39) splice site probably benign
IGL01291:Dock3 APN 9 106,835,599 (GRCm39) splice site probably benign
IGL01391:Dock3 APN 9 106,784,433 (GRCm39) missense possibly damaging 0.55
IGL01399:Dock3 APN 9 106,870,670 (GRCm39) missense probably benign 0.06
IGL01660:Dock3 APN 9 106,909,563 (GRCm39) splice site probably benign
IGL01752:Dock3 APN 9 106,902,512 (GRCm39) splice site probably benign
IGL01820:Dock3 APN 9 106,773,092 (GRCm39) missense probably damaging 1.00
IGL01908:Dock3 APN 9 106,783,861 (GRCm39) missense possibly damaging 0.81
IGL02191:Dock3 APN 9 106,815,340 (GRCm39) missense probably benign
IGL02227:Dock3 APN 9 106,939,254 (GRCm39) missense probably damaging 0.98
IGL02309:Dock3 APN 9 106,790,351 (GRCm39) missense probably damaging 1.00
IGL02408:Dock3 APN 9 106,790,298 (GRCm39) splice site probably benign
IGL02469:Dock3 APN 9 106,863,215 (GRCm39) missense probably damaging 0.98
IGL02545:Dock3 APN 9 106,939,271 (GRCm39) missense probably damaging 1.00
IGL02894:Dock3 APN 9 106,807,298 (GRCm39) missense probably benign 0.00
IGL02934:Dock3 APN 9 106,900,944 (GRCm39) missense probably benign 0.01
IGL03027:Dock3 APN 9 106,870,677 (GRCm39) missense probably damaging 0.98
IGL03068:Dock3 APN 9 106,841,958 (GRCm39) missense possibly damaging 0.82
IGL03128:Dock3 APN 9 106,909,491 (GRCm39) missense probably benign 0.05
IGL03161:Dock3 APN 9 106,900,987 (GRCm39) missense probably damaging 0.99
IGL03263:Dock3 APN 9 106,807,330 (GRCm39) splice site probably benign
IGL03279:Dock3 APN 9 106,788,447 (GRCm39) splice site probably benign
IGL03366:Dock3 APN 9 106,882,632 (GRCm39) missense probably benign 0.01
Implosion UTSW 9 106,815,125 (GRCm39) missense probably benign 0.00
Squeeze UTSW 9 106,807,242 (GRCm39) missense probably damaging 1.00
Tight UTSW 9 106,872,080 (GRCm39) missense probably damaging 1.00
ANU05:Dock3 UTSW 9 106,772,862 (GRCm39) missense probably benign
R0025:Dock3 UTSW 9 106,790,467 (GRCm39) missense possibly damaging 0.90
R0025:Dock3 UTSW 9 106,790,467 (GRCm39) missense possibly damaging 0.90
R0030:Dock3 UTSW 9 106,789,512 (GRCm39) missense possibly damaging 0.64
R0076:Dock3 UTSW 9 106,788,685 (GRCm39) splice site probably benign
R0076:Dock3 UTSW 9 106,788,685 (GRCm39) splice site probably benign
R0206:Dock3 UTSW 9 106,874,195 (GRCm39) nonsense probably null
R0208:Dock3 UTSW 9 106,874,195 (GRCm39) nonsense probably null
R0384:Dock3 UTSW 9 106,779,094 (GRCm39) splice site probably benign
R0610:Dock3 UTSW 9 106,900,987 (GRCm39) missense probably damaging 0.99
R0731:Dock3 UTSW 9 106,847,055 (GRCm39) missense probably damaging 1.00
R1184:Dock3 UTSW 9 106,846,999 (GRCm39) missense probably damaging 1.00
R1350:Dock3 UTSW 9 106,791,831 (GRCm39) missense possibly damaging 0.52
R1393:Dock3 UTSW 9 106,788,548 (GRCm39) missense probably damaging 1.00
R1424:Dock3 UTSW 9 106,790,392 (GRCm39) missense probably damaging 1.00
R1469:Dock3 UTSW 9 106,832,908 (GRCm39) missense probably benign 0.37
R1469:Dock3 UTSW 9 106,832,908 (GRCm39) missense probably benign 0.37
R1539:Dock3 UTSW 9 106,874,112 (GRCm39) missense probably benign 0.23
R1539:Dock3 UTSW 9 106,829,563 (GRCm39) missense probably damaging 1.00
R1571:Dock3 UTSW 9 106,815,158 (GRCm39) missense possibly damaging 0.92
R1682:Dock3 UTSW 9 106,851,040 (GRCm39) missense probably damaging 0.98
R1795:Dock3 UTSW 9 106,902,534 (GRCm39) missense probably damaging 0.99
R1987:Dock3 UTSW 9 106,985,620 (GRCm39) missense probably benign 0.01
R2000:Dock3 UTSW 9 106,870,160 (GRCm39) splice site probably benign
R2074:Dock3 UTSW 9 106,870,662 (GRCm39) missense possibly damaging 0.46
R2114:Dock3 UTSW 9 106,870,743 (GRCm39) missense probably benign 0.00
R2265:Dock3 UTSW 9 106,818,525 (GRCm39) missense probably damaging 1.00
R2269:Dock3 UTSW 9 106,818,525 (GRCm39) missense probably damaging 1.00
R2370:Dock3 UTSW 9 106,829,554 (GRCm39) missense probably damaging 1.00
R2377:Dock3 UTSW 9 106,773,090 (GRCm39) missense probably damaging 0.98
R2385:Dock3 UTSW 9 106,868,324 (GRCm39) missense probably damaging 1.00
R2426:Dock3 UTSW 9 106,791,740 (GRCm39) missense possibly damaging 0.76
R3076:Dock3 UTSW 9 106,818,725 (GRCm39) critical splice acceptor site probably null
R3122:Dock3 UTSW 9 106,788,542 (GRCm39) missense probably damaging 0.99
R4052:Dock3 UTSW 9 106,850,995 (GRCm39) missense probably damaging 0.99
R4294:Dock3 UTSW 9 106,807,242 (GRCm39) missense probably damaging 1.00
R4623:Dock3 UTSW 9 106,939,244 (GRCm39) missense possibly damaging 0.61
R4664:Dock3 UTSW 9 106,870,743 (GRCm39) missense possibly damaging 0.71
R4705:Dock3 UTSW 9 106,902,535 (GRCm39) missense probably damaging 1.00
R4771:Dock3 UTSW 9 106,829,557 (GRCm39) missense possibly damaging 0.89
R4898:Dock3 UTSW 9 106,870,171 (GRCm39) missense possibly damaging 0.75
R4898:Dock3 UTSW 9 106,807,266 (GRCm39) missense probably damaging 1.00
R4948:Dock3 UTSW 9 106,868,354 (GRCm39) missense probably damaging 0.96
R4961:Dock3 UTSW 9 106,818,515 (GRCm39) missense probably damaging 1.00
R4986:Dock3 UTSW 9 106,809,182 (GRCm39) missense probably damaging 1.00
R5065:Dock3 UTSW 9 106,832,883 (GRCm39) missense probably damaging 1.00
R5081:Dock3 UTSW 9 106,868,292 (GRCm39) missense probably damaging 1.00
R5101:Dock3 UTSW 9 106,846,980 (GRCm39) missense probably damaging 1.00
R5135:Dock3 UTSW 9 106,810,196 (GRCm39) missense probably damaging 1.00
R5227:Dock3 UTSW 9 106,863,269 (GRCm39) missense probably damaging 1.00
R5257:Dock3 UTSW 9 106,874,124 (GRCm39) missense probably damaging 1.00
R5258:Dock3 UTSW 9 106,874,124 (GRCm39) missense probably damaging 1.00
R5273:Dock3 UTSW 9 106,777,904 (GRCm39) critical splice donor site probably null
R5322:Dock3 UTSW 9 106,779,028 (GRCm39) missense probably benign 0.14
R5482:Dock3 UTSW 9 106,855,937 (GRCm39) nonsense probably null
R5553:Dock3 UTSW 9 106,868,309 (GRCm39) missense possibly damaging 0.81
R5631:Dock3 UTSW 9 106,832,898 (GRCm39) missense probably benign 0.01
R5739:Dock3 UTSW 9 106,850,995 (GRCm39) missense possibly damaging 0.92
R5838:Dock3 UTSW 9 106,772,687 (GRCm39) missense possibly damaging 0.51
R5888:Dock3 UTSW 9 106,901,002 (GRCm39) missense probably benign 0.12
R5960:Dock3 UTSW 9 106,788,554 (GRCm39) nonsense probably null
R5974:Dock3 UTSW 9 106,871,261 (GRCm39) missense probably damaging 1.00
R6116:Dock3 UTSW 9 106,809,161 (GRCm39) missense probably damaging 1.00
R6162:Dock3 UTSW 9 106,841,998 (GRCm39) missense possibly damaging 0.88
R6176:Dock3 UTSW 9 106,790,147 (GRCm39) missense probably benign 0.05
R6219:Dock3 UTSW 9 106,872,080 (GRCm39) missense probably damaging 1.00
R6238:Dock3 UTSW 9 106,790,147 (GRCm39) missense probably benign 0.05
R6266:Dock3 UTSW 9 106,841,952 (GRCm39) missense probably damaging 0.99
R6291:Dock3 UTSW 9 106,785,631 (GRCm39) missense probably benign
R6531:Dock3 UTSW 9 106,844,415 (GRCm39) missense probably benign
R6567:Dock3 UTSW 9 106,773,946 (GRCm39) missense probably benign 0.13
R6572:Dock3 UTSW 9 106,866,674 (GRCm39) missense probably damaging 0.99
R6620:Dock3 UTSW 9 106,815,125 (GRCm39) missense probably benign 0.00
R6726:Dock3 UTSW 9 107,036,651 (GRCm39) nonsense probably null
R7085:Dock3 UTSW 9 106,779,086 (GRCm39) missense probably damaging 1.00
R7151:Dock3 UTSW 9 106,841,916 (GRCm39) missense possibly damaging 0.68
R7320:Dock3 UTSW 9 106,772,723 (GRCm39) missense probably benign 0.20
R7357:Dock3 UTSW 9 106,882,568 (GRCm39) missense probably benign 0.34
R7423:Dock3 UTSW 9 106,844,370 (GRCm39) missense probably damaging 0.98
R7426:Dock3 UTSW 9 106,772,782 (GRCm39) missense probably benign
R7439:Dock3 UTSW 9 106,900,931 (GRCm39) missense probably damaging 1.00
R7452:Dock3 UTSW 9 106,866,664 (GRCm39) missense probably damaging 1.00
R7470:Dock3 UTSW 9 106,882,644 (GRCm39) missense probably damaging 1.00
R7879:Dock3 UTSW 9 106,785,700 (GRCm39) missense probably benign 0.05
R8047:Dock3 UTSW 9 106,870,208 (GRCm39) missense possibly damaging 0.93
R8308:Dock3 UTSW 9 106,790,371 (GRCm39) missense probably benign 0.00
R8837:Dock3 UTSW 9 106,774,539 (GRCm39) missense probably benign
R8862:Dock3 UTSW 9 106,855,927 (GRCm39) missense probably damaging 1.00
R8952:Dock3 UTSW 9 106,850,958 (GRCm39) missense probably benign 0.03
R9230:Dock3 UTSW 9 106,807,223 (GRCm39) missense probably damaging 1.00
R9269:Dock3 UTSW 9 106,818,522 (GRCm39) missense probably benign 0.01
R9272:Dock3 UTSW 9 106,774,569 (GRCm39) missense probably benign 0.00
R9344:Dock3 UTSW 9 106,870,763 (GRCm39) missense probably damaging 1.00
R9757:Dock3 UTSW 9 106,901,035 (GRCm39) missense possibly damaging 0.48
R9764:Dock3 UTSW 9 106,959,713 (GRCm39) missense probably benign 0.00
R9766:Dock3 UTSW 9 106,788,483 (GRCm39) missense probably benign 0.01
X0023:Dock3 UTSW 9 106,863,197 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACAGTCACGGAGCACATGTC -3'
(R):5'- AGAGGACATGAGCTCTTCCTTC -3'

Sequencing Primer
(F):5'- TCGGTAAGGACAAAAGTTTCACCTG -3'
(R):5'- GGACATGAGCTCTTCCTTCTGACAG -3'
Posted On 2016-06-06