Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Dock3'

390714

Institutional Source

Beutler Lab

Gene Symbol

Dock3

Ensembl Gene

ENSMUSG00000039716

Gene Name

dedicator of cyto-kinesis 3

Synonyms

PBP, Moca

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.569) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106892825-107231909 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106937906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1254 (Y1254C)

Ref Sequence

ENSEMBL: ENSMUSP00000047652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044532]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000044532
AA Change: Y1254C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000047652
Gene: ENSMUSG00000039716
AA Change: Y1254C

Domain	Start	End	E-Value	Type
SH3	9	66	3.85e-9	SMART
Pfam:DOCK_N	69	412	1.4e-120	PFAM
Pfam:DOCK-C2	417	608	7.7e-56	PFAM
low complexity region	854	867	N/A	INTRINSIC
low complexity region	892	916	N/A	INTRINSIC
Pfam:DHR-2	1121	1628	9e-133	PFAM
low complexity region	1679	1690	N/A	INTRINSIC
low complexity region	1693	1704	N/A	INTRINSIC
low complexity region	1730	1754	N/A	INTRINSIC
low complexity region	1880	1902	N/A	INTRINSIC
low complexity region	1963	1977	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000168759
AA Change: Y120C

SMART Domains

Protein: ENSMUSP00000131410
Gene: ENSMUSG00000039716
AA Change: Y120C

Domain	Start	End	E-Value	Type
Pfam:DHR-2	1	241	4e-48	PFAM

Meta Mutation Damage Score

0.6289

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the central nervous system (CNS). It encodes a member of the DOCK (dedicator of cytokinesis) family of guanine nucleotide exchange factors (GEFs). This protein, dedicator of cytokinesis 3 (DOCK3), is also known as modifier of cell adhesion (MOCA) and presenilin-binding protein (PBP). The DOCK3 and DOCK1, -2 and -4 share several conserved amino acids in their DHR-2 (DOCK homology region 2) domains that are required for GEF activity, and bind directly to WAVE proteins [Wiskott-Aldrich syndrome protein (WASP) family Verprolin-homologous proteins] via their DHR-1 domains. The DOCK3 induces axonal outgrowth in CNS by stimulating membrane recruitment of the WAVE complex and activating the small G protein Rac1. This gene is associated with an attention deficit hyperactivity disorder-like phenotype by a complex chromosomal rearrangement. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors and muscular weakness associated with axonal dystrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Atad5	T	A	11: 80,094,676	S196R	probably benign	Het
Bcam	T	A	7: 19,756,860		probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
Gpr45	A	G	1: 43,032,649	I151V	probably benign	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Nostrin	A	T	2: 69,175,713	Q247L	possibly damaging	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pam	C	A	1: 97,821,917	D839Y	probably damaging	Het
Pds5a	A	G	5: 65,637,814	V693A	probably damaging	Het
Pigo	A	T	4: 43,021,337	L535Q	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rad51c	T	C	11: 87,397,754	H201R	probably benign	Het
Rims2	A	T	15: 39,517,869		probably null	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Serpini2	T	A	3: 75,259,477	T158S	probably damaging	Het
Slc12a3	A	G	8: 94,346,351	R701G	probably damaging	Het
Slc1a6	A	G	10: 78,814,602	E558G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tbr1	A	T	2: 61,806,002	I241F	possibly damaging	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Dock3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00940:Dock3	APN	9	106911377	splice site	probably benign
IGL01067:Dock3	APN	9	107082373	critical splice donor site	probably null
IGL01160:Dock3	APN	9	106906688	missense	probably damaging	1.00
IGL01290:Dock3	APN	9	106958400	splice site	probably benign
IGL01291:Dock3	APN	9	106958400	splice site	probably benign
IGL01391:Dock3	APN	9	106907234	missense	possibly damaging	0.55
IGL01399:Dock3	APN	9	106993471	missense	probably benign	0.06
IGL01660:Dock3	APN	9	107032364	splice site	probably benign
IGL01752:Dock3	APN	9	107025313	splice site	probably benign
IGL01820:Dock3	APN	9	106895893	missense	probably damaging	1.00
IGL01908:Dock3	APN	9	106906662	missense	possibly damaging	0.81
IGL02191:Dock3	APN	9	106938141	missense	probably benign
IGL02227:Dock3	APN	9	107062055	missense	probably damaging	0.98
IGL02309:Dock3	APN	9	106913152	missense	probably damaging	1.00
IGL02408:Dock3	APN	9	106913099	splice site	probably benign
IGL02469:Dock3	APN	9	106986016	missense	probably damaging	0.98
IGL02545:Dock3	APN	9	107062072	missense	probably damaging	1.00
IGL02894:Dock3	APN	9	106930099	missense	probably benign	0.00
IGL02934:Dock3	APN	9	107023745	missense	probably benign	0.01
IGL03027:Dock3	APN	9	106993478	missense	probably damaging	0.98
IGL03068:Dock3	APN	9	106964759	missense	possibly damaging	0.82
IGL03128:Dock3	APN	9	107032292	missense	probably benign	0.05
IGL03161:Dock3	APN	9	107023788	missense	probably damaging	0.99
IGL03263:Dock3	APN	9	106930131	splice site	probably benign
IGL03279:Dock3	APN	9	106911248	splice site	probably benign
IGL03366:Dock3	APN	9	107005433	missense	probably benign	0.01
Implosion	UTSW	9	106937926	missense	probably benign	0.00
Squeeze	UTSW	9	106930043	missense	probably damaging	1.00
Tight	UTSW	9	106994881	missense	probably damaging	1.00
ANU05:Dock3	UTSW	9	106895663	missense	probably benign
R0025:Dock3	UTSW	9	106913268	missense	possibly damaging	0.90
R0025:Dock3	UTSW	9	106913268	missense	possibly damaging	0.90
R0030:Dock3	UTSW	9	106912313	missense	possibly damaging	0.64
R0076:Dock3	UTSW	9	106911486	splice site	probably benign
R0076:Dock3	UTSW	9	106911486	splice site	probably benign
R0206:Dock3	UTSW	9	106996996	nonsense	probably null
R0208:Dock3	UTSW	9	106996996	nonsense	probably null
R0384:Dock3	UTSW	9	106901895	splice site	probably benign
R0610:Dock3	UTSW	9	107023788	missense	probably damaging	0.99
R0731:Dock3	UTSW	9	106969856	missense	probably damaging	1.00
R1184:Dock3	UTSW	9	106969800	missense	probably damaging	1.00
R1350:Dock3	UTSW	9	106914632	missense	possibly damaging	0.52
R1393:Dock3	UTSW	9	106911349	missense	probably damaging	1.00
R1424:Dock3	UTSW	9	106913193	missense	probably damaging	1.00
R1469:Dock3	UTSW	9	106955709	missense	probably benign	0.37
R1469:Dock3	UTSW	9	106955709	missense	probably benign	0.37
R1539:Dock3	UTSW	9	106952364	missense	probably damaging	1.00
R1539:Dock3	UTSW	9	106996913	missense	probably benign	0.23
R1571:Dock3	UTSW	9	106937959	missense	possibly damaging	0.92
R1682:Dock3	UTSW	9	106973841	missense	probably damaging	0.98
R1795:Dock3	UTSW	9	107025335	missense	probably damaging	0.99
R1987:Dock3	UTSW	9	107108421	missense	probably benign	0.01
R2000:Dock3	UTSW	9	106992961	splice site	probably benign
R2074:Dock3	UTSW	9	106993463	missense	possibly damaging	0.46
R2114:Dock3	UTSW	9	106993544	missense	probably benign	0.00
R2265:Dock3	UTSW	9	106941326	missense	probably damaging	1.00
R2269:Dock3	UTSW	9	106941326	missense	probably damaging	1.00
R2370:Dock3	UTSW	9	106952355	missense	probably damaging	1.00
R2377:Dock3	UTSW	9	106895891	missense	probably damaging	0.98
R2385:Dock3	UTSW	9	106991125	missense	probably damaging	1.00
R2426:Dock3	UTSW	9	106914541	missense	possibly damaging	0.76
R3076:Dock3	UTSW	9	106941526	critical splice acceptor site	probably null
R3122:Dock3	UTSW	9	106911343	missense	probably damaging	0.99
R4052:Dock3	UTSW	9	106973796	missense	probably damaging	0.99
R4294:Dock3	UTSW	9	106930043	missense	probably damaging	1.00
R4623:Dock3	UTSW	9	107062045	missense	possibly damaging	0.61
R4664:Dock3	UTSW	9	106993544	missense	possibly damaging	0.71
R4705:Dock3	UTSW	9	107025336	missense	probably damaging	1.00
R4771:Dock3	UTSW	9	106952358	missense	possibly damaging	0.89
R4898:Dock3	UTSW	9	106930067	missense	probably damaging	1.00
R4898:Dock3	UTSW	9	106992972	missense	possibly damaging	0.75
R4948:Dock3	UTSW	9	106991155	missense	probably damaging	0.96
R4961:Dock3	UTSW	9	106941316	missense	probably damaging	1.00
R4986:Dock3	UTSW	9	106931983	missense	probably damaging	1.00
R5065:Dock3	UTSW	9	106955684	missense	probably damaging	1.00
R5081:Dock3	UTSW	9	106991093	missense	probably damaging	1.00
R5101:Dock3	UTSW	9	106969781	missense	probably damaging	1.00
R5135:Dock3	UTSW	9	106932997	missense	probably damaging	1.00
R5227:Dock3	UTSW	9	106986070	missense	probably damaging	1.00
R5257:Dock3	UTSW	9	106996925	missense	probably damaging	1.00
R5258:Dock3	UTSW	9	106996925	missense	probably damaging	1.00
R5273:Dock3	UTSW	9	106900705	critical splice donor site	probably null
R5322:Dock3	UTSW	9	106901829	missense	probably benign	0.14
R5482:Dock3	UTSW	9	106978738	nonsense	probably null
R5553:Dock3	UTSW	9	106991110	missense	possibly damaging	0.81
R5631:Dock3	UTSW	9	106955699	missense	probably benign	0.01
R5739:Dock3	UTSW	9	106973796	missense	possibly damaging	0.92
R5838:Dock3	UTSW	9	106895488	missense	possibly damaging	0.51
R5888:Dock3	UTSW	9	107023803	missense	probably benign	0.12
R5960:Dock3	UTSW	9	106911355	nonsense	probably null
R5974:Dock3	UTSW	9	106994062	missense	probably damaging	1.00
R6116:Dock3	UTSW	9	106931962	missense	probably damaging	1.00
R6162:Dock3	UTSW	9	106964799	missense	possibly damaging	0.88
R6176:Dock3	UTSW	9	106912948	missense	probably benign	0.05
R6219:Dock3	UTSW	9	106994881	missense	probably damaging	1.00
R6238:Dock3	UTSW	9	106912948	missense	probably benign	0.05
R6266:Dock3	UTSW	9	106964753	missense	probably damaging	0.99
R6291:Dock3	UTSW	9	106908432	missense	probably benign
R6531:Dock3	UTSW	9	106967216	missense	probably benign
R6567:Dock3	UTSW	9	106896747	missense	probably benign	0.13
R6572:Dock3	UTSW	9	106989475	missense	probably damaging	0.99
R6620:Dock3	UTSW	9	106937926	missense	probably benign	0.00
R6726:Dock3	UTSW	9	107159452	nonsense	probably null
R7085:Dock3	UTSW	9	106901887	missense	probably damaging	1.00
R7151:Dock3	UTSW	9	106964717	missense	possibly damaging	0.68
R7320:Dock3	UTSW	9	106895524	missense	probably benign	0.20
R7357:Dock3	UTSW	9	107005369	missense	probably benign	0.34
R7423:Dock3	UTSW	9	106967171	missense	probably damaging	0.98
R7426:Dock3	UTSW	9	106895583	missense	probably benign
R7439:Dock3	UTSW	9	107023732	missense	probably damaging	1.00
R7452:Dock3	UTSW	9	106989465	missense	probably damaging	1.00
R7470:Dock3	UTSW	9	107005445	missense	probably damaging	1.00
R7879:Dock3	UTSW	9	106908501	missense	probably benign	0.05
R8047:Dock3	UTSW	9	106993009	missense	possibly damaging	0.93
R8308:Dock3	UTSW	9	106913172	missense	probably benign	0.00
R8837:Dock3	UTSW	9	106897340	missense	probably benign
R8862:Dock3	UTSW	9	106978728	missense	probably damaging	1.00
R8952:Dock3	UTSW	9	106973759	missense	probably benign	0.03
R9230:Dock3	UTSW	9	106930024	missense	probably damaging	1.00
R9269:Dock3	UTSW	9	106941323	missense	probably benign	0.01
R9272:Dock3	UTSW	9	106897370	missense	probably benign	0.00
R9344:Dock3	UTSW	9	106993564	missense	probably damaging	1.00
R9757:Dock3	UTSW	9	107023836	missense	possibly damaging	0.48
R9764:Dock3	UTSW	9	107082514	missense	probably benign	0.00
R9766:Dock3	UTSW	9	106911284	missense	probably benign	0.01
X0023:Dock3	UTSW	9	106985998	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- ACAGTCACGGAGCACATGTC -3'
(R):5'- AGAGGACATGAGCTCTTCCTTC -3'

Sequencing Primer
(F):5'- TCGGTAAGGACAAAAGTTTCACCTG -3'
(R):5'- GGACATGAGCTCTTCCTTCTGACAG -3'

Posted On

2016-06-06