Incidental Mutation 'R5054:Slc1a6'
ID 390717
Institutional Source Beutler Lab
Gene Symbol Slc1a6
Ensembl Gene ENSMUSG00000005357
Gene Name solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
Synonyms EAAT4
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 78616330-78650599 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78650436 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 558 (E558G)
Ref Sequence ENSEMBL: ENSMUSP00000005490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005490]
AlphaFold O35544
Predicted Effect probably damaging
Transcript: ENSMUST00000005490
AA Change: E558G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357
AA Change: E558G

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:SDF 55 519 8.5e-129 PFAM
Meta Mutation Damage Score 0.1081 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene survive well and display no obvious abnormalities of behavior or brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,837,315 (GRCm39) Y257H probably damaging Het
Adam28 C T 14: 68,855,164 (GRCm39) C659Y probably damaging Het
Adamtsl2 G A 2: 26,991,732 (GRCm39) E627K probably damaging Het
Atad5 T A 11: 79,985,502 (GRCm39) S196R probably benign Het
Bcam T A 7: 19,490,785 (GRCm39) probably benign Het
Birc6 A G 17: 74,962,320 (GRCm39) H3978R probably damaging Het
Btbd7 T C 12: 102,804,471 (GRCm39) I190V probably benign Het
Ccdc8 T C 7: 16,728,970 (GRCm39) V153A probably damaging Het
Cyp2a5 C G 7: 26,540,529 (GRCm39) R68G probably damaging Het
Dock3 T C 9: 106,815,105 (GRCm39) Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 (GRCm39) E2794G possibly damaging Het
Dytn C A 1: 63,700,318 (GRCm39) V271L possibly damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif2s2 A C 2: 154,734,590 (GRCm39) probably null Het
Fndc7 A G 3: 108,788,663 (GRCm39) S193P probably damaging Het
Fzr1 G A 10: 81,207,253 (GRCm39) probably benign Het
Gm17472 T C 6: 42,957,938 (GRCm39) I69T probably damaging Het
Gmppa C A 1: 75,416,015 (GRCm39) Y137* probably null Het
Gpr45 A G 1: 43,071,809 (GRCm39) I151V probably benign Het
H1f0 G A 15: 78,912,973 (GRCm39) A18T probably damaging Het
Hbb-bh1 C T 7: 103,491,063 (GRCm39) V114I probably benign Het
Impa2 C A 18: 67,439,797 (GRCm39) P98Q probably damaging Het
Kazn T C 4: 141,835,957 (GRCm39) N573D unknown Het
Kcna2 A T 3: 107,011,656 (GRCm39) D79V probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kif13a A G 13: 46,956,122 (GRCm39) Y561H probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klra1 T A 6: 130,352,247 (GRCm39) Q165L probably damaging Het
Mat2b T A 11: 40,570,869 (GRCm39) R318S probably damaging Het
Mgat4d G A 8: 84,094,837 (GRCm39) probably null Het
Mtor T A 4: 148,641,312 (GRCm39) probably null Het
Nostrin A T 2: 69,006,057 (GRCm39) Q247L possibly damaging Het
Obi1 C T 14: 104,745,466 (GRCm39) G70E probably damaging Het
Obscn T C 11: 58,964,443 (GRCm39) E3033G probably damaging Het
Pam C A 1: 97,749,642 (GRCm39) D839Y probably damaging Het
Pds5a A G 5: 65,795,157 (GRCm39) V693A probably damaging Het
Pigo A T 4: 43,021,337 (GRCm39) L535Q probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Ptar1 G T 19: 23,671,729 (GRCm39) R44L probably damaging Het
Rad51c T C 11: 87,288,580 (GRCm39) H201R probably benign Het
Rims2 A T 15: 39,381,265 (GRCm39) probably null Het
Rpl22l1 T G 3: 28,860,985 (GRCm39) S67A possibly damaging Het
Rps10 A G 17: 27,849,454 (GRCm39) S143P probably damaging Het
Rundc1 T C 11: 101,315,967 (GRCm39) V13A probably benign Het
Sephs2 C A 7: 126,872,564 (GRCm39) M176I probably benign Het
Serpina16 C T 12: 103,641,189 (GRCm39) V179I probably benign Het
Serpini2 T A 3: 75,166,784 (GRCm39) T158S probably damaging Het
Slc12a3 A G 8: 95,072,979 (GRCm39) R701G probably damaging Het
Ssx2ip T C 3: 146,136,672 (GRCm39) probably benign Het
Tbr1 A T 2: 61,636,346 (GRCm39) I241F possibly damaging Het
Tgfa G C 6: 86,247,064 (GRCm39) probably null Het
Tlr12 T A 4: 128,511,063 (GRCm39) K396* probably null Het
Tmppe A G 9: 114,235,026 (GRCm39) I442V probably benign Het
Tubb3 T C 8: 124,147,607 (GRCm39) V180A probably damaging Het
Vmn1r222 A G 13: 23,416,901 (GRCm39) V104A probably damaging Het
Vmn2r95 G T 17: 18,671,708 (GRCm39) V482L possibly damaging Het
Zfp184 G T 13: 22,143,452 (GRCm39) R386L possibly damaging Het
Zfp444 T A 7: 6,192,792 (GRCm39) V270E probably damaging Het
Zfp985 A T 4: 147,667,438 (GRCm39) Y102F probably damaging Het
Other mutations in Slc1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc1a6 APN 10 78,637,647 (GRCm39) missense probably damaging 1.00
IGL00496:Slc1a6 APN 10 78,629,142 (GRCm39) missense probably damaging 1.00
IGL01099:Slc1a6 APN 10 78,624,831 (GRCm39) missense possibly damaging 0.67
IGL02299:Slc1a6 APN 10 78,629,137 (GRCm39) missense probably damaging 1.00
IGL02677:Slc1a6 APN 10 78,624,898 (GRCm39) missense probably damaging 1.00
IGL02705:Slc1a6 APN 10 78,637,788 (GRCm39) missense probably damaging 1.00
IGL03024:Slc1a6 APN 10 78,650,442 (GRCm39) missense probably benign
IGL03185:Slc1a6 APN 10 78,637,741 (GRCm39) missense probably damaging 1.00
IGL03046:Slc1a6 UTSW 10 78,636,008 (GRCm39) missense probably benign 0.19
R0183:Slc1a6 UTSW 10 78,627,067 (GRCm39) missense probably damaging 1.00
R0373:Slc1a6 UTSW 10 78,637,756 (GRCm39) nonsense probably null
R0730:Slc1a6 UTSW 10 78,631,842 (GRCm39) missense probably benign 0.13
R0774:Slc1a6 UTSW 10 78,648,658 (GRCm39) missense probably benign 0.03
R0838:Slc1a6 UTSW 10 78,632,056 (GRCm39) missense probably damaging 1.00
R1449:Slc1a6 UTSW 10 78,635,951 (GRCm39) missense probably damaging 0.99
R1822:Slc1a6 UTSW 10 78,648,765 (GRCm39) nonsense probably null
R1853:Slc1a6 UTSW 10 78,648,758 (GRCm39) missense probably damaging 0.97
R1854:Slc1a6 UTSW 10 78,648,758 (GRCm39) missense probably damaging 0.97
R1855:Slc1a6 UTSW 10 78,648,758 (GRCm39) missense probably damaging 0.97
R1866:Slc1a6 UTSW 10 78,627,183 (GRCm39) missense probably damaging 0.99
R2073:Slc1a6 UTSW 10 78,635,964 (GRCm39) missense possibly damaging 0.93
R2279:Slc1a6 UTSW 10 78,624,882 (GRCm39) missense probably benign 0.12
R2360:Slc1a6 UTSW 10 78,648,718 (GRCm39) missense possibly damaging 0.91
R2939:Slc1a6 UTSW 10 78,650,448 (GRCm39) makesense probably null
R3111:Slc1a6 UTSW 10 78,624,915 (GRCm39) missense probably damaging 0.99
R3926:Slc1a6 UTSW 10 78,648,715 (GRCm39) missense possibly damaging 0.91
R4116:Slc1a6 UTSW 10 78,623,723 (GRCm39) missense probably benign 0.00
R4798:Slc1a6 UTSW 10 78,635,952 (GRCm39) missense probably damaging 1.00
R4916:Slc1a6 UTSW 10 78,632,085 (GRCm39) missense probably damaging 1.00
R5166:Slc1a6 UTSW 10 78,632,103 (GRCm39) critical splice donor site probably null
R5304:Slc1a6 UTSW 10 78,629,141 (GRCm39) missense probably damaging 1.00
R5367:Slc1a6 UTSW 10 78,623,637 (GRCm39) missense probably damaging 1.00
R5554:Slc1a6 UTSW 10 78,631,816 (GRCm39) missense probably benign 0.00
R5635:Slc1a6 UTSW 10 78,624,925 (GRCm39) missense possibly damaging 0.67
R5773:Slc1a6 UTSW 10 78,629,111 (GRCm39) splice site probably null
R6117:Slc1a6 UTSW 10 78,624,822 (GRCm39) missense possibly damaging 0.72
R6167:Slc1a6 UTSW 10 78,637,671 (GRCm39) missense probably benign 0.40
R6174:Slc1a6 UTSW 10 78,637,741 (GRCm39) missense probably damaging 1.00
R6221:Slc1a6 UTSW 10 78,635,910 (GRCm39) missense probably damaging 0.98
R6323:Slc1a6 UTSW 10 78,648,721 (GRCm39) missense probably damaging 1.00
R6339:Slc1a6 UTSW 10 78,635,919 (GRCm39) missense possibly damaging 0.94
R6670:Slc1a6 UTSW 10 78,623,646 (GRCm39) missense probably benign 0.00
R7166:Slc1a6 UTSW 10 78,648,646 (GRCm39) missense possibly damaging 0.96
R7292:Slc1a6 UTSW 10 78,650,438 (GRCm39) missense possibly damaging 0.84
R7548:Slc1a6 UTSW 10 78,650,265 (GRCm39) missense probably damaging 1.00
R7779:Slc1a6 UTSW 10 78,631,789 (GRCm39) missense probably damaging 0.96
R7843:Slc1a6 UTSW 10 78,632,094 (GRCm39) missense probably damaging 1.00
R8068:Slc1a6 UTSW 10 78,648,706 (GRCm39) missense possibly damaging 0.96
R8190:Slc1a6 UTSW 10 78,627,067 (GRCm39) missense probably damaging 1.00
R8210:Slc1a6 UTSW 10 78,632,091 (GRCm39) missense possibly damaging 0.95
R8846:Slc1a6 UTSW 10 78,637,781 (GRCm39) missense probably damaging 1.00
R9216:Slc1a6 UTSW 10 78,637,692 (GRCm39) missense probably damaging 1.00
R9660:Slc1a6 UTSW 10 78,648,698 (GRCm39) missense probably benign 0.06
R9798:Slc1a6 UTSW 10 78,629,167 (GRCm39) critical splice donor site probably null
Z1176:Slc1a6 UTSW 10 78,631,909 (GRCm39) missense possibly damaging 0.65
Z1177:Slc1a6 UTSW 10 78,648,728 (GRCm39) missense probably damaging 1.00
Z1177:Slc1a6 UTSW 10 78,627,101 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGTGACCGACTTCGTACAATGAC -3'
(R):5'- GGTTGTTCTTATATTTCGAGCACAC -3'

Sequencing Primer
(F):5'- CTTCGTACAATGACCAATGTACTGGG -3'
(R):5'- TGATGAACACACGTTGGATACC -3'
Posted On 2016-06-06