Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Slc1a6'

390717

Institutional Source

Beutler Lab

Gene Symbol

Slc1a6

Ensembl Gene

ENSMUSG00000005357

Gene Name

solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6

Synonyms

EAAT4

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78780496-78814765 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 78814602 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 558 (E558G)

Ref Sequence

ENSEMBL: ENSMUSP00000005490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005490]

AlphaFold

O35544

Predicted Effect

probably damaging
Transcript: ENSMUST00000005490
AA Change: E558G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357
AA Change: E558G

Domain	Start	End	E-Value	Type
low complexity region	27	43	N/A	INTRINSIC
Pfam:SDF	55	519	8.5e-129	PFAM

Meta Mutation Damage Score

0.1081

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

MGI Phenotype

PHENOTYPE: Mice homozygous for disruptions in this gene survive well and display no obvious abnormalities of behavior or brain structure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Atad5	T	A	11: 80,094,676	S196R	probably benign	Het
Bcam	T	A	7: 19,756,860		probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dock3	T	C	9: 106,937,906	Y1254C	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
Gpr45	A	G	1: 43,032,649	I151V	probably benign	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Nostrin	A	T	2: 69,175,713	Q247L	possibly damaging	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pam	C	A	1: 97,821,917	D839Y	probably damaging	Het
Pds5a	A	G	5: 65,637,814	V693A	probably damaging	Het
Pigo	A	T	4: 43,021,337	L535Q	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rad51c	T	C	11: 87,397,754	H201R	probably benign	Het
Rims2	A	T	15: 39,517,869		probably null	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Serpini2	T	A	3: 75,259,477	T158S	probably damaging	Het
Slc12a3	A	G	8: 94,346,351	R701G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tbr1	A	T	2: 61,806,002	I241F	possibly damaging	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Slc1a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Slc1a6	APN	10	78801813	missense	probably damaging	1.00
IGL00496:Slc1a6	APN	10	78793308	missense	probably damaging	1.00
IGL01099:Slc1a6	APN	10	78788997	missense	possibly damaging	0.67
IGL02299:Slc1a6	APN	10	78793303	missense	probably damaging	1.00
IGL02677:Slc1a6	APN	10	78789064	missense	probably damaging	1.00
IGL02705:Slc1a6	APN	10	78801954	missense	probably damaging	1.00
IGL03024:Slc1a6	APN	10	78814608	missense	probably benign
IGL03185:Slc1a6	APN	10	78801907	missense	probably damaging	1.00
IGL03046:Slc1a6	UTSW	10	78800174	missense	probably benign	0.19
R0183:Slc1a6	UTSW	10	78791233	missense	probably damaging	1.00
R0373:Slc1a6	UTSW	10	78801922	nonsense	probably null
R0730:Slc1a6	UTSW	10	78796008	missense	probably benign	0.13
R0774:Slc1a6	UTSW	10	78812824	missense	probably benign	0.03
R0838:Slc1a6	UTSW	10	78796222	missense	probably damaging	1.00
R1449:Slc1a6	UTSW	10	78800117	missense	probably damaging	0.99
R1822:Slc1a6	UTSW	10	78812931	nonsense	probably null
R1853:Slc1a6	UTSW	10	78812924	missense	probably damaging	0.97
R1854:Slc1a6	UTSW	10	78812924	missense	probably damaging	0.97
R1855:Slc1a6	UTSW	10	78812924	missense	probably damaging	0.97
R1866:Slc1a6	UTSW	10	78791349	missense	probably damaging	0.99
R2073:Slc1a6	UTSW	10	78800130	missense	possibly damaging	0.93
R2279:Slc1a6	UTSW	10	78789048	missense	probably benign	0.12
R2360:Slc1a6	UTSW	10	78812884	missense	possibly damaging	0.91
R2939:Slc1a6	UTSW	10	78814614	makesense	probably null
R3111:Slc1a6	UTSW	10	78789081	missense	probably damaging	0.99
R3926:Slc1a6	UTSW	10	78812881	missense	possibly damaging	0.91
R4116:Slc1a6	UTSW	10	78787889	missense	probably benign	0.00
R4798:Slc1a6	UTSW	10	78800118	missense	probably damaging	1.00
R4916:Slc1a6	UTSW	10	78796251	missense	probably damaging	1.00
R5166:Slc1a6	UTSW	10	78796269	critical splice donor site	probably null
R5304:Slc1a6	UTSW	10	78793307	missense	probably damaging	1.00
R5367:Slc1a6	UTSW	10	78787803	missense	probably damaging	1.00
R5554:Slc1a6	UTSW	10	78795982	missense	probably benign	0.00
R5635:Slc1a6	UTSW	10	78789091	missense	possibly damaging	0.67
R5773:Slc1a6	UTSW	10	78793277	splice site	probably null
R6117:Slc1a6	UTSW	10	78788988	missense	possibly damaging	0.72
R6167:Slc1a6	UTSW	10	78801837	missense	probably benign	0.40
R6174:Slc1a6	UTSW	10	78801907	missense	probably damaging	1.00
R6221:Slc1a6	UTSW	10	78800076	missense	probably damaging	0.98
R6323:Slc1a6	UTSW	10	78812887	missense	probably damaging	1.00
R6339:Slc1a6	UTSW	10	78800085	missense	possibly damaging	0.94
R6670:Slc1a6	UTSW	10	78787812	missense	probably benign	0.00
R7166:Slc1a6	UTSW	10	78812812	missense	possibly damaging	0.96
R7292:Slc1a6	UTSW	10	78814604	missense	possibly damaging	0.84
R7548:Slc1a6	UTSW	10	78814431	missense	probably damaging	1.00
R7779:Slc1a6	UTSW	10	78795955	missense	probably damaging	0.96
R7843:Slc1a6	UTSW	10	78796260	missense	probably damaging	1.00
R8068:Slc1a6	UTSW	10	78812872	missense	possibly damaging	0.96
R8190:Slc1a6	UTSW	10	78791233	missense	probably damaging	1.00
R8210:Slc1a6	UTSW	10	78796257	missense	possibly damaging	0.95
R8846:Slc1a6	UTSW	10	78801947	missense	probably damaging	1.00
R9216:Slc1a6	UTSW	10	78801858	missense	probably damaging	1.00
R9660:Slc1a6	UTSW	10	78812864	missense	probably benign	0.06
R9798:Slc1a6	UTSW	10	78793333	critical splice donor site	probably null
Z1176:Slc1a6	UTSW	10	78796075	missense	possibly damaging	0.65
Z1177:Slc1a6	UTSW	10	78791267	missense	possibly damaging	0.79
Z1177:Slc1a6	UTSW	10	78812894	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGACCGACTTCGTACAATGAC -3'
(R):5'- GGTTGTTCTTATATTTCGAGCACAC -3'

Sequencing Primer
(F):5'- CTTCGTACAATGACCAATGTACTGGG -3'
(R):5'- TGATGAACACACGTTGGATACC -3'

Posted On

2016-06-06