Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Atad5'

390722

Institutional Source

Beutler Lab

Gene Symbol

Atad5

Ensembl Gene

ENSMUSG00000017550

Gene Name

ATPase family, AAA domain containing 5

Synonyms

LOC237877, C130052G03Rik

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80089400-80135794 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80094676 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 196 (S196R)

Ref Sequence

ENSEMBL: ENSMUSP00000103874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000108239]

AlphaFold

Q4QY64

Predicted Effect

probably benign
Transcript: ENSMUST00000017694
AA Change: S196R

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550
AA Change: S196R

Domain	Start	End	E-Value	Type
low complexity region	298	311	N/A	INTRINSIC
low complexity region	327	342	N/A	INTRINSIC
low complexity region	467	486	N/A	INTRINSIC
coiled coil region	665	697	N/A	INTRINSIC
low complexity region	798	807	N/A	INTRINSIC
AAA	1111	1347	5.14e-5	SMART
Blast:AAA	1409	1526	1e-31	BLAST
low complexity region	1573	1583	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108239
AA Change: S196R

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550
AA Change: S196R

Domain	Start	End	E-Value	Type
low complexity region	298	311	N/A	INTRINSIC
low complexity region	327	342	N/A	INTRINSIC
low complexity region	467	486	N/A	INTRINSIC
coiled coil region	665	697	N/A	INTRINSIC
low complexity region	798	807	N/A	INTRINSIC
AAA	1108	1344	5.14e-5	SMART
Blast:AAA	1406	1523	1e-31	BLAST
low complexity region	1570	1580	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for a gene trap allele exhibit genomic instability, premature death, and a wide spectrum of spontaneous tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Bcam	T	A	7: 19,756,860		probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dock3	T	C	9: 106,937,906	Y1254C	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
Gpr45	A	G	1: 43,032,649	I151V	probably benign	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Nostrin	A	T	2: 69,175,713	Q247L	possibly damaging	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pam	C	A	1: 97,821,917	D839Y	probably damaging	Het
Pds5a	A	G	5: 65,637,814	V693A	probably damaging	Het
Pigo	A	T	4: 43,021,337	L535Q	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rad51c	T	C	11: 87,397,754	H201R	probably benign	Het
Rims2	A	T	15: 39,517,869		probably null	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Serpini2	T	A	3: 75,259,477	T158S	probably damaging	Het
Slc12a3	A	G	8: 94,346,351	R701G	probably damaging	Het
Slc1a6	A	G	10: 78,814,602	E558G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tbr1	A	T	2: 61,806,002	I241F	possibly damaging	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Atad5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Atad5	APN	11	80132858	missense	probably benign	0.22
IGL00916:Atad5	APN	11	80119000	missense	probably damaging	1.00
IGL01348:Atad5	APN	11	80095564	missense	probably benign	0.00
IGL01601:Atad5	APN	11	80095517	missense	probably benign	0.45
IGL01916:Atad5	APN	11	80112839	critical splice donor site	probably null
IGL02028:Atad5	APN	11	80134110	missense	probably benign	0.20
IGL02095:Atad5	APN	11	80094707	missense	probably benign	0.24
IGL02142:Atad5	APN	11	80094197	missense	probably benign	0.00
IGL02206:Atad5	APN	11	80094183	missense	probably damaging	1.00
IGL02385:Atad5	APN	11	80094627	missense	probably benign	0.04
IGL02858:Atad5	APN	11	80089775	missense	probably damaging	1.00
IGL02962:Atad5	APN	11	80108579	missense	possibly damaging	0.86
PIT4362001:Atad5	UTSW	11	80111567	missense	probably benign	0.04
R0040:Atad5	UTSW	11	80098014	missense	probably benign
R0157:Atad5	UTSW	11	80089817	missense	possibly damaging	0.74
R0211:Atad5	UTSW	11	80095647	missense	probably benign	0.00
R0211:Atad5	UTSW	11	80095647	missense	probably benign	0.00
R0319:Atad5	UTSW	11	80120790	splice site	probably benign
R0401:Atad5	UTSW	11	80120699	missense	probably benign	0.11
R0426:Atad5	UTSW	11	80112832	missense	probably benign	0.14
R0452:Atad5	UTSW	11	80106421	missense	probably damaging	0.98
R0496:Atad5	UTSW	11	80100356	missense	probably benign	0.08
R1691:Atad5	UTSW	11	80095532	missense	probably benign	0.00
R1812:Atad5	UTSW	11	80133047	missense	probably damaging	0.98
R2070:Atad5	UTSW	11	80098052	splice site	probably null
R2071:Atad5	UTSW	11	80098052	splice site	probably null
R2153:Atad5	UTSW	11	80106377	missense	probably benign	0.04
R2415:Atad5	UTSW	11	80094251	missense	probably damaging	1.00
R3917:Atad5	UTSW	11	80103294	missense	probably null	0.97
R4025:Atad5	UTSW	11	80120686	missense	probably damaging	1.00
R4464:Atad5	UTSW	11	80100311	splice site	probably null
R4561:Atad5	UTSW	11	80095889	missense	probably benign	0.01
R4579:Atad5	UTSW	11	80095191	missense	probably damaging	1.00
R4844:Atad5	UTSW	11	80114311	splice site	probably null
R4853:Atad5	UTSW	11	80095272	missense	probably damaging	1.00
R4873:Atad5	UTSW	11	80120689	missense	probably damaging	1.00
R4875:Atad5	UTSW	11	80120689	missense	probably damaging	1.00
R5226:Atad5	UTSW	11	80095062	missense	probably damaging	0.99
R5397:Atad5	UTSW	11	80111493	missense	probably damaging	1.00
R5449:Atad5	UTSW	11	80124108	missense	probably damaging	1.00
R5571:Atad5	UTSW	11	80111556	missense	probably benign	0.05
R5575:Atad5	UTSW	11	80100323	missense	probably benign	0.02
R5857:Atad5	UTSW	11	80131329	missense	probably benign	0.06
R5927:Atad5	UTSW	11	80127285	missense	probably damaging	1.00
R5928:Atad5	UTSW	11	80094177	missense	probably damaging	1.00
R5949:Atad5	UTSW	11	80096009	nonsense	probably null
R6102:Atad5	UTSW	11	80111572	critical splice donor site	probably null
R6254:Atad5	UTSW	11	80127389	missense	probably damaging	0.96
R6562:Atad5	UTSW	11	80133206	missense	probably benign	0.26
R6744:Atad5	UTSW	11	80134032	missense	probably benign	0.00
R7092:Atad5	UTSW	11	80120720	missense	possibly damaging	0.68
R7202:Atad5	UTSW	11	80089775	missense	probably damaging	1.00
R7345:Atad5	UTSW	11	80096006	missense	probably damaging	1.00
R7352:Atad5	UTSW	11	80103343	critical splice donor site	probably null
R7358:Atad5	UTSW	11	80133036	missense	probably benign	0.32
R7420:Atad5	UTSW	11	80095862	missense	probably benign	0.06
R7453:Atad5	UTSW	11	80119143	critical splice donor site	probably null
R7990:Atad5	UTSW	11	80133253	nonsense	probably null
R8012:Atad5	UTSW	11	80094240	missense	probably damaging	1.00
R8152:Atad5	UTSW	11	80095170	missense	possibly damaging	0.59
R8421:Atad5	UTSW	11	80094558	missense	probably damaging	0.98
R8842:Atad5	UTSW	11	80110084	missense	possibly damaging	0.87
R8918:Atad5	UTSW	11	80095647	missense	probably benign	0.02
R8943:Atad5	UTSW	11	80095698	missense	possibly damaging	0.86
R8944:Atad5	UTSW	11	80095698	missense	possibly damaging	0.86
R9134:Atad5	UTSW	11	80133105	missense	probably benign	0.00
R9137:Atad5	UTSW	11	80095655	missense	probably damaging	1.00
R9301:Atad5	UTSW	11	80096019	missense	probably damaging	1.00
R9372:Atad5	UTSW	11	80094268	missense	possibly damaging	0.68
R9404:Atad5	UTSW	11	80114238	missense	probably damaging	1.00
R9443:Atad5	UTSW	11	80132562	missense	probably benign	0.01
R9471:Atad5	UTSW	11	80132698	missense	possibly damaging	0.65
R9577:Atad5	UTSW	11	80114170	missense	probably damaging	1.00
R9656:Atad5	UTSW	11	80089716	start gained	probably benign
R9659:Atad5	UTSW	11	80089716	start gained	probably benign
R9661:Atad5	UTSW	11	80089716	start gained	probably benign
RF003:Atad5	UTSW	11	80111560	missense	probably damaging	0.99
X0024:Atad5	UTSW	11	80132783	missense	probably benign	0.02
Z1176:Atad5	UTSW	11	80094896	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCAGGATGAGTGTCCAGTTG -3'
(R):5'- CACTTTAGCTGCCTTGTGAC -3'

Sequencing Primer
(F):5'- CAGGATGAGTGTCCAGTTGAAATTAG -3'
(R):5'- CCTCATAGGAGACAGTAATTGTACTC -3'

Posted On

2016-06-06