Incidental Mutation 'R5054:Rad51c'
ID390723
Institutional Source Beutler Lab
Gene Symbol Rad51c
Ensembl Gene ENSMUSG00000007646
Gene NameRAD51 paralog C
SynonymsRad51l2
MMRRC Submission 042644-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5054 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87376645-87404954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87397754 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 201 (H201R)
Ref Sequence ENSEMBL: ENSMUSP00000007790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007790] [ENSMUST00000067692] [ENSMUST00000129400] [ENSMUST00000153073]
Predicted Effect probably benign
Transcript: ENSMUST00000007790
AA Change: H201R

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000007790
Gene: ENSMUSG00000007646
AA Change: H201R

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Rad51 91 359 1.7e-32 PFAM
Pfam:AAA_25 97 298 1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067692
AA Change: H183R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064079
Gene: ENSMUSG00000007646
AA Change: H183R

DomainStartEndE-ValueType
Pfam:Rad51 73 341 1.9e-32 PFAM
Pfam:AAA_25 79 280 7.6e-10 PFAM
Pfam:KaiC 91 137 2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129400
SMART Domains Protein: ENSMUSP00000121928
Gene: ENSMUSG00000007646

DomainStartEndE-ValueType
PDB:1PZN|G 10 125 2e-9 PDB
SCOP:d1g8ya_ 91 125 9e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153073
AA Change: H183R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122811
Gene: ENSMUSG00000007646
AA Change: H183R

DomainStartEndE-ValueType
Pfam:Rad51 73 315 3.2e-28 PFAM
Pfam:AAA_25 79 280 2.1e-10 PFAM
Pfam:KaiC 91 137 1.7e-8 PFAM
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality. Mice carrying a null and a hypomorphic allele have partial penetrance of male and female infertility due to defects in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,689,501 Y257H probably damaging Het
Adam28 C T 14: 68,617,715 C659Y probably damaging Het
Adamtsl2 G A 2: 27,101,720 E627K probably damaging Het
Atad5 T A 11: 80,094,676 S196R probably benign Het
Bcam T A 7: 19,756,860 probably benign Het
Birc6 A G 17: 74,655,325 H3978R probably damaging Het
Btbd7 T C 12: 102,838,212 I190V probably benign Het
Ccdc8 T C 7: 16,995,045 V153A probably damaging Het
Cyp2a5 C G 7: 26,841,104 R68G probably damaging Het
Dock3 T C 9: 106,937,906 Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 E2794G possibly damaging Het
Dytn C A 1: 63,661,159 V271L possibly damaging Het
Eif2s2 A C 2: 154,892,670 probably null Het
Fndc7 A G 3: 108,881,347 S193P probably damaging Het
Fzr1 G A 10: 81,371,419 probably benign Het
Gm17472 T C 6: 42,981,004 I69T probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gmppa C A 1: 75,439,371 Y137* probably null Het
Gpr45 A G 1: 43,032,649 I151V probably benign Het
H1f0 G A 15: 79,028,773 A18T probably damaging Het
Hbb-bh1 C T 7: 103,841,856 V114I probably benign Het
Impa2 C A 18: 67,306,727 P98Q probably damaging Het
Kazn T C 4: 142,108,646 N573D unknown Het
Kcna2 A T 3: 107,104,340 D79V probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kif13a A G 13: 46,802,646 Y561H probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra1 T A 6: 130,375,284 Q165L probably damaging Het
Mat2b T A 11: 40,680,042 R318S probably damaging Het
Mgat4d G A 8: 83,368,208 probably null Het
Mtor T A 4: 148,556,855 probably null Het
Nostrin A T 2: 69,175,713 Q247L possibly damaging Het
Obscn T C 11: 59,073,617 E3033G probably damaging Het
Pam C A 1: 97,821,917 D839Y probably damaging Het
Pds5a A G 5: 65,637,814 V693A probably damaging Het
Pigo A T 4: 43,021,337 L535Q probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptar1 G T 19: 23,694,365 R44L probably damaging Het
Rims2 A T 15: 39,517,869 probably null Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Rpl22l1 T G 3: 28,806,836 S67A possibly damaging Het
Rps10 A G 17: 27,630,480 S143P probably damaging Het
Rundc1 T C 11: 101,425,141 V13A probably benign Het
Sephs2 C A 7: 127,273,392 M176I probably benign Het
Serpina16 C T 12: 103,674,930 V179I probably benign Het
Serpini2 T A 3: 75,259,477 T158S probably damaging Het
Slc12a3 A G 8: 94,346,351 R701G probably damaging Het
Slc1a6 A G 10: 78,814,602 E558G probably damaging Het
Ssx2ip T C 3: 146,430,917 probably benign Het
Tbr1 A T 2: 61,806,002 I241F possibly damaging Het
Tgfa G C 6: 86,270,082 probably null Het
Tlr12 T A 4: 128,617,270 K396* probably null Het
Tmppe A G 9: 114,405,958 I442V probably benign Het
Tubb3 T C 8: 123,420,868 V180A probably damaging Het
Vmn1r222 A G 13: 23,232,731 V104A probably damaging Het
Vmn2r95 G T 17: 18,451,446 V482L possibly damaging Het
Zfp184 G T 13: 21,959,282 R386L possibly damaging Het
Zfp444 T A 7: 6,189,793 V270E probably damaging Het
Zfp985 A T 4: 147,582,981 Y102F probably damaging Het
Other mutations in Rad51c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Rad51c APN 11 87380855 missense possibly damaging 0.92
IGL03096:Rad51c APN 11 87388646 missense probably damaging 1.00
IGL03493:Rad51c APN 11 87397753 missense probably benign 0.00
R0415:Rad51c UTSW 11 87397655 missense probably damaging 0.99
R1875:Rad51c UTSW 11 87388643 missense probably damaging 0.99
R2098:Rad51c UTSW 11 87402763 missense probably benign
R4172:Rad51c UTSW 11 87402746 missense probably damaging 1.00
R4798:Rad51c UTSW 11 87395378 missense probably damaging 1.00
R5182:Rad51c UTSW 11 87397719 missense possibly damaging 0.85
R5381:Rad51c UTSW 11 87397633 missense probably benign 0.00
R6087:Rad51c UTSW 11 87380879 missense probably benign 0.02
R7066:Rad51c UTSW 11 87402676 missense possibly damaging 0.56
R7714:Rad51c UTSW 11 87401450 missense probably benign 0.00
R8242:Rad51c UTSW 11 87389886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGGCATTAAGTTTCTACTATTGC -3'
(R):5'- AATCACAGTTTACAGTCATTTTGCAA -3'

Sequencing Primer
(F):5'- TTTGTATAATCGATACTCTCAAAGGC -3'
(R):5'- TTTATGATTGGCACACTGT -3'
Posted On2016-06-06