Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Rad51c'

390723

Institutional Source

Beutler Lab

Gene Symbol

Rad51c

Ensembl Gene

ENSMUSG00000007646

Gene Name

RAD51 paralog C

Synonyms

Rad51l2

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87376645-87404954 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 87397754 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 201 (H201R)

Ref Sequence

ENSEMBL: ENSMUSP00000007790 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007790] [ENSMUST00000067692] [ENSMUST00000129400] [ENSMUST00000153073]

AlphaFold

Q924H5

Predicted Effect

probably benign
Transcript: ENSMUST00000007790
AA Change: H201R

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000007790
Gene: ENSMUSG00000007646
AA Change: H201R

Domain	Start	End	E-Value	Type
low complexity region	10	26	N/A	INTRINSIC
Pfam:Rad51	91	359	1.7e-32	PFAM
Pfam:AAA_25	97	298	1e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000067692
AA Change: H183R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000064079
Gene: ENSMUSG00000007646
AA Change: H183R

Domain	Start	End	E-Value	Type
Pfam:Rad51	73	341	1.9e-32	PFAM
Pfam:AAA_25	79	280	7.6e-10	PFAM
Pfam:KaiC	91	137	2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129400

SMART Domains

Protein: ENSMUSP00000121928
Gene: ENSMUSG00000007646

Domain	Start	End	E-Value	Type
PDB:1PZN\|G	10	125	2e-9	PDB
SCOP:d1g8ya_	91	125	9e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000153073
AA Change: H183R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000122811
Gene: ENSMUSG00000007646
AA Change: H183R

Domain	Start	End	E-Value	Type
Pfam:Rad51	73	315	3.2e-28	PFAM
Pfam:AAA_25	79	280	2.1e-10	PFAM
Pfam:KaiC	91	137	1.7e-8	PFAM

Meta Mutation Damage Score

0.0710

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality. Mice carrying a null and a hypomorphic allele have partial penetrance of male and female infertility due to defects in meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Atad5	T	A	11: 80,094,676	S196R	probably benign	Het
Bcam	T	A	7: 19,756,860		probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dock3	T	C	9: 106,937,906	Y1254C	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
Gpr45	A	G	1: 43,032,649	I151V	probably benign	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Nostrin	A	T	2: 69,175,713	Q247L	possibly damaging	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pam	C	A	1: 97,821,917	D839Y	probably damaging	Het
Pds5a	A	G	5: 65,637,814	V693A	probably damaging	Het
Pigo	A	T	4: 43,021,337	L535Q	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rims2	A	T	15: 39,517,869		probably null	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Serpini2	T	A	3: 75,259,477	T158S	probably damaging	Het
Slc12a3	A	G	8: 94,346,351	R701G	probably damaging	Het
Slc1a6	A	G	10: 78,814,602	E558G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tbr1	A	T	2: 61,806,002	I241F	possibly damaging	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Rad51c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02457:Rad51c	APN	11	87380855	missense	possibly damaging	0.92
IGL03096:Rad51c	APN	11	87388646	missense	probably damaging	1.00
IGL03493:Rad51c	APN	11	87397753	missense	probably benign	0.00
R0415:Rad51c	UTSW	11	87397655	missense	probably damaging	0.99
R1875:Rad51c	UTSW	11	87388643	missense	probably damaging	0.99
R2098:Rad51c	UTSW	11	87402763	missense	probably benign
R4172:Rad51c	UTSW	11	87402746	missense	probably damaging	1.00
R4798:Rad51c	UTSW	11	87395378	missense	probably damaging	1.00
R5182:Rad51c	UTSW	11	87397719	missense	possibly damaging	0.85
R5381:Rad51c	UTSW	11	87397633	missense	probably benign	0.00
R6087:Rad51c	UTSW	11	87380879	missense	probably benign	0.02
R7066:Rad51c	UTSW	11	87402676	missense	possibly damaging	0.56
R7714:Rad51c	UTSW	11	87401450	missense	probably benign	0.00
R8242:Rad51c	UTSW	11	87389886	missense	probably damaging	1.00
R9054:Rad51c	UTSW	11	87402716	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AACTGGCATTAAGTTTCTACTATTGC -3'
(R):5'- AATCACAGTTTACAGTCATTTTGCAA -3'

Sequencing Primer
(F):5'- TTTGTATAATCGATACTCTCAAAGGC -3'
(R):5'- TTTATGATTGGCACACTGT -3'

Posted On

2016-06-06