Incidental Mutation 'R5054:Rundc1'
ID 390724
Institutional Source Beutler Lab
Gene Symbol Rundc1
Ensembl Gene ENSMUSG00000035007
Gene Name RUN domain containing 1
Synonyms
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.734) question?
Stock # R5054 (G1)
Quality Score 168
Status Validated
Chromosome 11
Chromosomal Location 101315910-101326492 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101315967 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 13 (V13A)
Ref Sequence ENSEMBL: ENSMUSP00000042151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040561] [ENSMUST00000093933] [ENSMUST00000103102] [ENSMUST00000107252] [ENSMUST00000107257] [ENSMUST00000107259]
AlphaFold Q0VDN7
Predicted Effect probably benign
Transcript: ENSMUST00000040561
AA Change: V13A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042151
Gene: ENSMUSG00000035007
AA Change: V13A

DomainStartEndE-ValueType
low complexity region 43 75 N/A INTRINSIC
coiled coil region 80 102 N/A INTRINSIC
coiled coil region 165 201 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
RUN 540 602 2.77e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093933
SMART Domains Protein: ENSMUSP00000091465
Gene: ENSMUSG00000097487

DomainStartEndE-ValueType
Pfam:CS 6 80 8.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103102
SMART Domains Protein: ENSMUSP00000099391
Gene: ENSMUSG00000097487

DomainStartEndE-ValueType
Pfam:CS 6 80 7.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107252
SMART Domains Protein: ENSMUSP00000102873
Gene: ENSMUSG00000097487

DomainStartEndE-ValueType
Pfam:CS 6 80 9.6e-9 PFAM
low complexity region 141 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107257
SMART Domains Protein: ENSMUSP00000102878
Gene: ENSMUSG00000097239

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 91 214 1.4e-8 PFAM
tRNA_SAD 309 352 1.43e-6 SMART
low complexity region 389 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107259
SMART Domains Protein: ENSMUSP00000102880
Gene: ENSMUSG00000097239

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 109 232 3.4e-9 PFAM
tRNA_SAD 327 370 1.43e-6 SMART
low complexity region 407 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149706
SMART Domains Protein: ENSMUSP00000116399
Gene: ENSMUSG00000097487

DomainStartEndE-ValueType
SCOP:d1ejfa_ 2 41 6e-11 SMART
PDB:1EJF|B 2 56 2e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150957
Meta Mutation Damage Score 0.0819 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,837,315 (GRCm39) Y257H probably damaging Het
Adam28 C T 14: 68,855,164 (GRCm39) C659Y probably damaging Het
Adamtsl2 G A 2: 26,991,732 (GRCm39) E627K probably damaging Het
Atad5 T A 11: 79,985,502 (GRCm39) S196R probably benign Het
Bcam T A 7: 19,490,785 (GRCm39) probably benign Het
Birc6 A G 17: 74,962,320 (GRCm39) H3978R probably damaging Het
Btbd7 T C 12: 102,804,471 (GRCm39) I190V probably benign Het
Ccdc8 T C 7: 16,728,970 (GRCm39) V153A probably damaging Het
Cyp2a5 C G 7: 26,540,529 (GRCm39) R68G probably damaging Het
Dock3 T C 9: 106,815,105 (GRCm39) Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 (GRCm39) E2794G possibly damaging Het
Dytn C A 1: 63,700,318 (GRCm39) V271L possibly damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif2s2 A C 2: 154,734,590 (GRCm39) probably null Het
Fndc7 A G 3: 108,788,663 (GRCm39) S193P probably damaging Het
Fzr1 G A 10: 81,207,253 (GRCm39) probably benign Het
Gm17472 T C 6: 42,957,938 (GRCm39) I69T probably damaging Het
Gmppa C A 1: 75,416,015 (GRCm39) Y137* probably null Het
Gpr45 A G 1: 43,071,809 (GRCm39) I151V probably benign Het
H1f0 G A 15: 78,912,973 (GRCm39) A18T probably damaging Het
Hbb-bh1 C T 7: 103,491,063 (GRCm39) V114I probably benign Het
Impa2 C A 18: 67,439,797 (GRCm39) P98Q probably damaging Het
Kazn T C 4: 141,835,957 (GRCm39) N573D unknown Het
Kcna2 A T 3: 107,011,656 (GRCm39) D79V probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kif13a A G 13: 46,956,122 (GRCm39) Y561H probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klra1 T A 6: 130,352,247 (GRCm39) Q165L probably damaging Het
Mat2b T A 11: 40,570,869 (GRCm39) R318S probably damaging Het
Mgat4d G A 8: 84,094,837 (GRCm39) probably null Het
Mtor T A 4: 148,641,312 (GRCm39) probably null Het
Nostrin A T 2: 69,006,057 (GRCm39) Q247L possibly damaging Het
Obi1 C T 14: 104,745,466 (GRCm39) G70E probably damaging Het
Obscn T C 11: 58,964,443 (GRCm39) E3033G probably damaging Het
Pam C A 1: 97,749,642 (GRCm39) D839Y probably damaging Het
Pds5a A G 5: 65,795,157 (GRCm39) V693A probably damaging Het
Pigo A T 4: 43,021,337 (GRCm39) L535Q probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Ptar1 G T 19: 23,671,729 (GRCm39) R44L probably damaging Het
Rad51c T C 11: 87,288,580 (GRCm39) H201R probably benign Het
Rims2 A T 15: 39,381,265 (GRCm39) probably null Het
Rpl22l1 T G 3: 28,860,985 (GRCm39) S67A possibly damaging Het
Rps10 A G 17: 27,849,454 (GRCm39) S143P probably damaging Het
Sephs2 C A 7: 126,872,564 (GRCm39) M176I probably benign Het
Serpina16 C T 12: 103,641,189 (GRCm39) V179I probably benign Het
Serpini2 T A 3: 75,166,784 (GRCm39) T158S probably damaging Het
Slc12a3 A G 8: 95,072,979 (GRCm39) R701G probably damaging Het
Slc1a6 A G 10: 78,650,436 (GRCm39) E558G probably damaging Het
Ssx2ip T C 3: 146,136,672 (GRCm39) probably benign Het
Tbr1 A T 2: 61,636,346 (GRCm39) I241F possibly damaging Het
Tgfa G C 6: 86,247,064 (GRCm39) probably null Het
Tlr12 T A 4: 128,511,063 (GRCm39) K396* probably null Het
Tmppe A G 9: 114,235,026 (GRCm39) I442V probably benign Het
Tubb3 T C 8: 124,147,607 (GRCm39) V180A probably damaging Het
Vmn1r222 A G 13: 23,416,901 (GRCm39) V104A probably damaging Het
Vmn2r95 G T 17: 18,671,708 (GRCm39) V482L possibly damaging Het
Zfp184 G T 13: 22,143,452 (GRCm39) R386L possibly damaging Het
Zfp444 T A 7: 6,192,792 (GRCm39) V270E probably damaging Het
Zfp985 A T 4: 147,667,438 (GRCm39) Y102F probably damaging Het
Other mutations in Rundc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Rundc1 APN 11 101,325,100 (GRCm39) missense probably damaging 1.00
IGL01068:Rundc1 APN 11 101,324,968 (GRCm39) missense probably damaging 0.96
IGL02112:Rundc1 APN 11 101,324,425 (GRCm39) missense probably benign 0.01
R0379:Rundc1 UTSW 11 101,315,973 (GRCm39) missense probably benign 0.01
R1847:Rundc1 UTSW 11 101,324,507 (GRCm39) missense probably benign
R1959:Rundc1 UTSW 11 101,322,322 (GRCm39) missense probably damaging 1.00
R2185:Rundc1 UTSW 11 101,316,157 (GRCm39) missense probably benign 0.34
R2225:Rundc1 UTSW 11 101,322,170 (GRCm39) splice site probably benign
R2323:Rundc1 UTSW 11 101,316,101 (GRCm39) missense probably damaging 0.98
R3791:Rundc1 UTSW 11 101,325,027 (GRCm39) missense probably damaging 0.96
R4599:Rundc1 UTSW 11 101,324,752 (GRCm39) missense probably damaging 1.00
R4660:Rundc1 UTSW 11 101,324,830 (GRCm39) missense possibly damaging 0.89
R4871:Rundc1 UTSW 11 101,324,874 (GRCm39) missense probably benign 0.18
R5058:Rundc1 UTSW 11 101,316,363 (GRCm39) missense probably benign
R6349:Rundc1 UTSW 11 101,324,988 (GRCm39) missense probably benign 0.07
R6965:Rundc1 UTSW 11 101,324,737 (GRCm39) missense possibly damaging 0.96
R7240:Rundc1 UTSW 11 101,322,374 (GRCm39) critical splice donor site probably null
R7286:Rundc1 UTSW 11 101,320,413 (GRCm39) missense probably benign 0.00
R7624:Rundc1 UTSW 11 101,324,305 (GRCm39) missense possibly damaging 0.88
R8243:Rundc1 UTSW 11 101,316,384 (GRCm39) missense probably benign 0.00
R8322:Rundc1 UTSW 11 101,322,992 (GRCm39) missense probably benign 0.01
R8401:Rundc1 UTSW 11 101,324,383 (GRCm39) missense probably damaging 0.99
R8934:Rundc1 UTSW 11 101,322,327 (GRCm39) missense probably damaging 1.00
R9081:Rundc1 UTSW 11 101,316,053 (GRCm39) missense probably damaging 0.99
Z1176:Rundc1 UTSW 11 101,324,560 (GRCm39) missense probably damaging 1.00
Z1176:Rundc1 UTSW 11 101,322,948 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGCATTAAAGTCCCGAGGG -3'
(R):5'- AGGCAAAGTCTTCGAGCTCG -3'

Sequencing Primer
(F):5'- CCTCCCGAGATTGGAGG -3'
(R):5'- AGACGGAACTGCACCTGC -3'
Posted On 2016-06-06