Incidental Mutation 'R0437:Atp4a'
ID39073
Institutional Source Beutler Lab
Gene Symbol Atp4a
Ensembl Gene ENSMUSG00000005553
Gene NameATPase, H+/K+ exchanging, gastric, alpha polypeptide
SynonymsH+/K+-ATPase alpha, H+K+-transporting alpha 1
MMRRC Submission 038638-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R0437 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30712209-30725534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 30720101 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 659 (R659G)
Ref Sequence ENSEMBL: ENSMUSP00000131964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]
Predicted Effect probably benign
Transcript: ENSMUST00000005692
AA Change: R659G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: R659G

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167761
Predicted Effect probably benign
Transcript: ENSMUST00000170371
AA Change: R659G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: R659G

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171014
Meta Mutation Damage Score 0.0961 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,953 L21P probably damaging Het
4833420G17Rik G A 13: 119,470,095 R291K probably benign Het
4932438A13Rik A T 3: 36,989,804 H2820L possibly damaging Het
Abca2 T C 2: 25,442,845 S1519P probably damaging Het
Abcb11 G A 2: 69,257,295 A1042V probably damaging Het
Abcc10 A T 17: 46,312,919 probably null Het
Abcc10 G T 17: 46,312,920 probably benign Het
Alkbh3 A C 2: 93,981,569 L240V probably damaging Het
Apol10b T C 15: 77,585,408 S190G probably benign Het
Atp1a3 C A 7: 24,998,967 C135F probably benign Het
BC030499 T C 11: 78,291,536 L57P probably benign Het
Bicra A G 7: 15,988,762 S277P possibly damaging Het
Bmp8a T C 4: 123,316,897 E275G probably benign Het
Ccdc102a T C 8: 94,913,426 E80G probably damaging Het
Cdh23 T C 10: 60,410,797 D954G probably damaging Het
Chrm4 A G 2: 91,928,443 T399A possibly damaging Het
Clcn3 A G 8: 60,934,537 V199A possibly damaging Het
Crlf1 T C 8: 70,499,514 probably null Het
Crx G T 7: 15,871,146 S57* probably null Het
Cyp4f16 A G 17: 32,537,098 I34V possibly damaging Het
Daxx T C 17: 33,913,624 V576A probably benign Het
Ddx17 C T 15: 79,537,471 R351H probably damaging Het
Dhx38 T C 8: 109,558,629 probably benign Het
Dnd1 T C 18: 36,764,499 probably benign Het
Dync1i2 A T 2: 71,227,825 probably null Het
E2f6 T C 12: 16,816,445 S52P probably benign Het
Epb41l4a A G 18: 33,880,273 F116S probably damaging Het
Ext1 T C 15: 53,106,106 N362S probably damaging Het
Fam227a C A 15: 79,643,988 K79N possibly damaging Het
Fam228a T A 12: 4,732,759 L111F probably damaging Het
Fat2 T C 11: 55,282,799 T2363A probably benign Het
Fat3 A T 9: 15,996,932 N2591K probably damaging Het
Frem2 A G 3: 53,653,015 M1357T possibly damaging Het
Frmd4b A T 6: 97,423,463 V29D probably damaging Het
G930045G22Rik A G 6: 50,846,938 noncoding transcript Het
Galnt3 A G 2: 66,107,229 S46P possibly damaging Het
Gmeb2 A G 2: 181,253,973 V468A possibly damaging Het
Herc2 C T 7: 56,219,815 R4271* probably null Het
Il5 C A 11: 53,723,906 probably benign Het
Ints9 G A 14: 64,986,369 probably benign Het
Itga10 T C 3: 96,649,137 F196S probably damaging Het
Itgb3bp T C 4: 99,781,889 T138A probably damaging Het
Kcnd1 G A X: 7,824,683 V281M probably benign Het
Lcp2 T C 11: 34,087,229 L391P probably benign Het
Lrrc66 T C 5: 73,607,687 Y671C probably benign Het
Mettl23 T C 11: 116,849,294 V197A possibly damaging Het
Mmp15 C A 8: 95,370,772 D456E probably benign Het
Mospd4 T C 18: 46,465,781 noncoding transcript Het
Mov10l1 C A 15: 89,005,312 H484N probably damaging Het
Mphosph9 T C 5: 124,315,568 Q197R probably benign Het
Ms4a1 T A 19: 11,256,569 probably null Het
Mybbp1a T C 11: 72,448,848 V919A possibly damaging Het
Mycbpap A T 11: 94,513,512 probably benign Het
Naip6 G A 13: 100,296,924 S1135F possibly damaging Het
Ndufc2 T A 7: 97,400,337 M50K probably benign Het
Npr2 T C 4: 43,648,082 V842A probably damaging Het
Ntsr2 G T 12: 16,653,695 G66W probably damaging Het
Obscn T C 11: 58,995,088 probably benign Het
Olfr1206 T A 2: 88,864,885 N93K probably benign Het
Olfr1219 T A 2: 89,074,612 I160F probably benign Het
Olfr427 G A 1: 174,100,399 G314R probably benign Het
Olfr820 T C 10: 130,018,096 V245A probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Otud4 T A 8: 79,669,997 H628Q probably benign Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pex16 G T 2: 92,375,592 R10L probably damaging Het
Pitpnm2 A G 5: 124,131,089 probably benign Het
Pom121l2 A G 13: 21,983,205 T549A possibly damaging Het
Prdm15 A T 16: 97,812,559 M470K probably benign Het
Prkag2 T A 5: 25,028,505 D49V possibly damaging Het
Prl3c1 A G 13: 27,199,464 M38V probably benign Het
Prpf18 T A 2: 4,643,761 I85F possibly damaging Het
Psg27 A G 7: 18,560,711 probably benign Het
Relt A G 7: 100,848,784 probably benign Het
Serpina3b A T 12: 104,130,670 N70I probably damaging Het
Slc19a3 T C 1: 83,022,565 S244G probably benign Het
Slc39a5 T C 10: 128,399,847 T81A possibly damaging Het
Slc7a2 G A 8: 40,904,526 G277D probably damaging Het
Slc9c1 C T 16: 45,599,887 probably benign Het
Slx1b A G 7: 126,692,581 F104L probably benign Het
Smg6 G A 11: 74,929,701 S266N probably damaging Het
Spata9 T C 13: 75,998,495 V162A possibly damaging Het
Szrd1 T C 4: 141,118,744 I47V probably benign Het
Tha1 G T 11: 117,868,575 L363M probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Tmem132d C T 5: 127,789,785 G684R probably damaging Het
Trim55 G A 3: 19,670,978 G220S probably benign Het
Ttn A G 2: 76,770,530 L18836P probably damaging Het
Ubn1 G T 16: 5,072,184 probably benign Het
Ush2a T G 1: 188,911,031 W4197G probably benign Het
Vmn1r189 A T 13: 22,102,061 V202E probably damaging Het
Vmn1r209 T C 13: 22,806,356 I55V probably benign Het
Vmn2r86 A T 10: 130,446,543 C735S probably damaging Het
Vwf A T 6: 125,566,318 D174V probably damaging Het
Zfp438 T C 18: 5,214,910 N16S probably damaging Het
Zfp444 C T 7: 6,189,409 T142I probably benign Het
Zfp804a A G 2: 82,053,791 M1V probably null Het
Zfp936 T G 7: 43,189,310 I67S probably benign Het
Zfp948 A T 17: 21,586,998 N151Y unknown Het
Other mutations in Atp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Atp4a APN 7 30713204 missense possibly damaging 0.95
IGL01327:Atp4a APN 7 30713250 missense possibly damaging 0.96
IGL01510:Atp4a APN 7 30720791 missense probably benign 0.02
IGL01763:Atp4a APN 7 30715518 missense probably benign 0.20
IGL02061:Atp4a APN 7 30715029 missense probably damaging 1.00
IGL02435:Atp4a APN 7 30717057 missense probably benign
IGL02903:Atp4a APN 7 30715919 missense probably benign 0.00
IGL03181:Atp4a APN 7 30724704 missense probably benign 0.02
IGL03350:Atp4a APN 7 30720867 missense probably damaging 1.00
sublytic UTSW 7 30715800 missense probably benign 0.32
IGL03097:Atp4a UTSW 7 30723037 missense probably benign 0.14
R0095:Atp4a UTSW 7 30720735 missense probably damaging 0.99
R0121:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0140:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0241:Atp4a UTSW 7 30717135 missense probably benign 0.00
R0624:Atp4a UTSW 7 30718999 missense probably benign
R1164:Atp4a UTSW 7 30717692 missense probably benign 0.00
R2105:Atp4a UTSW 7 30720368 critical splice donor site probably null
R2272:Atp4a UTSW 7 30715500 nonsense probably null
R2327:Atp4a UTSW 7 30720241 missense probably benign 0.16
R2881:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2990:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2992:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2993:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3123:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3125:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3441:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3442:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3686:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3687:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3845:Atp4a UTSW 7 30717115 missense probably null 0.99
R4027:Atp4a UTSW 7 30724952 splice site probably null
R4072:Atp4a UTSW 7 30715332 missense probably benign 0.09
R4433:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4454:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4457:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4458:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4510:Atp4a UTSW 7 30724253 nonsense probably null
R4511:Atp4a UTSW 7 30724253 nonsense probably null
R4576:Atp4a UTSW 7 30717722 missense probably benign 0.25
R4656:Atp4a UTSW 7 30719948 intron probably benign
R4661:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4662:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4852:Atp4a UTSW 7 30724268 missense probably benign 0.10
R4892:Atp4a UTSW 7 30712474 missense probably benign 0.07
R4907:Atp4a UTSW 7 30719092 missense possibly damaging 0.66
R5024:Atp4a UTSW 7 30715864 missense possibly damaging 0.82
R5254:Atp4a UTSW 7 30715530 missense probably damaging 1.00
R5318:Atp4a UTSW 7 30715329 missense probably damaging 1.00
R5340:Atp4a UTSW 7 30720806 missense probably benign
R5484:Atp4a UTSW 7 30720672 unclassified probably benign
R5729:Atp4a UTSW 7 30712426 missense possibly damaging 0.48
R5762:Atp4a UTSW 7 30719096 missense probably damaging 0.99
R5797:Atp4a UTSW 7 30712649 missense probably damaging 1.00
R6030:Atp4a UTSW 7 30722516 missense probably damaging 0.99
R6030:Atp4a UTSW 7 30722516 missense probably damaging 0.99
R6077:Atp4a UTSW 7 30715919 missense probably benign 0.00
R6243:Atp4a UTSW 7 30715957 missense possibly damaging 0.68
R6346:Atp4a UTSW 7 30715356 missense possibly damaging 0.84
R6459:Atp4a UTSW 7 30712462 missense probably benign 0.00
R6515:Atp4a UTSW 7 30712478 missense possibly damaging 0.78
R6773:Atp4a UTSW 7 30715377 missense probably damaging 0.98
R6854:Atp4a UTSW 7 30715008 missense probably benign 0.29
R7215:Atp4a UTSW 7 30717360 missense possibly damaging 0.61
R7271:Atp4a UTSW 7 30722519 missense probably benign 0.16
R7340:Atp4a UTSW 7 30716730 missense possibly damaging 0.94
R7457:Atp4a UTSW 7 30720767 missense probably benign 0.08
R7593:Atp4a UTSW 7 30724680 missense probably benign 0.08
R7712:Atp4a UTSW 7 30715553 missense probably damaging 0.96
R7762:Atp4a UTSW 7 30720036 missense probably damaging 0.96
Z1177:Atp4a UTSW 7 30717840 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GGGGACATTGCTCTGATCTGAAGG -3'
(R):5'- CAATCACCAGCTTCTGCTGAGGAC -3'

Sequencing Primer
(F):5'- CTCTGATCTGAAGGGGTGAAG -3'
(R):5'- TCAGTCAGTGTGGGTTGCA -3'
Posted On2013-05-23