Incidental Mutation 'R5054:Adam28'
ID 390733
Institutional Source Beutler Lab
Gene Symbol Adam28
Ensembl Gene ENSMUSG00000014725
Gene Name a disintegrin and metallopeptidase domain 28
Synonyms MDC-L, D430033C21Rik, Dtgn1, C130072N01Rik
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 68843476-68893291 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 68855164 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 659 (C659Y)
Ref Sequence ENSEMBL: ENSMUSP00000153354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022642] [ENSMUST00000111072] [ENSMUST00000224039]
AlphaFold Q9JLN6
Predicted Effect probably damaging
Transcript: ENSMUST00000022642
AA Change: C659Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022642
Gene: ENSMUSG00000014725
AA Change: C659Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.5e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.7e-19 PFAM
Pfam:Reprolysin 206 402 5.6e-70 PFAM
Pfam:Reprolysin_2 226 392 1e-16 PFAM
Pfam:Reprolysin_3 230 353 1.2e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111072
AA Change: C659Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106701
Gene: ENSMUSG00000014725
AA Change: C659Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.3e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.3e-19 PFAM
Pfam:Reprolysin 206 402 5.3e-70 PFAM
Pfam:Reprolysin_2 226 392 9.9e-17 PFAM
Pfam:Reprolysin_3 230 353 1.1e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224039
AA Change: C659Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230006
Meta Mutation Damage Score 0.3596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are typically membrane-anchored, although a form of this protein may be secreted. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein may bind to integrins and regulate lymphocyte migration by enhancing cell adhesion. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,837,315 (GRCm39) Y257H probably damaging Het
Adamtsl2 G A 2: 26,991,732 (GRCm39) E627K probably damaging Het
Atad5 T A 11: 79,985,502 (GRCm39) S196R probably benign Het
Bcam T A 7: 19,490,785 (GRCm39) probably benign Het
Birc6 A G 17: 74,962,320 (GRCm39) H3978R probably damaging Het
Btbd7 T C 12: 102,804,471 (GRCm39) I190V probably benign Het
Ccdc8 T C 7: 16,728,970 (GRCm39) V153A probably damaging Het
Cyp2a5 C G 7: 26,540,529 (GRCm39) R68G probably damaging Het
Dock3 T C 9: 106,815,105 (GRCm39) Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 (GRCm39) E2794G possibly damaging Het
Dytn C A 1: 63,700,318 (GRCm39) V271L possibly damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif2s2 A C 2: 154,734,590 (GRCm39) probably null Het
Fndc7 A G 3: 108,788,663 (GRCm39) S193P probably damaging Het
Fzr1 G A 10: 81,207,253 (GRCm39) probably benign Het
Gm17472 T C 6: 42,957,938 (GRCm39) I69T probably damaging Het
Gmppa C A 1: 75,416,015 (GRCm39) Y137* probably null Het
Gpr45 A G 1: 43,071,809 (GRCm39) I151V probably benign Het
H1f0 G A 15: 78,912,973 (GRCm39) A18T probably damaging Het
Hbb-bh1 C T 7: 103,491,063 (GRCm39) V114I probably benign Het
Impa2 C A 18: 67,439,797 (GRCm39) P98Q probably damaging Het
Kazn T C 4: 141,835,957 (GRCm39) N573D unknown Het
Kcna2 A T 3: 107,011,656 (GRCm39) D79V probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kif13a A G 13: 46,956,122 (GRCm39) Y561H probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klra1 T A 6: 130,352,247 (GRCm39) Q165L probably damaging Het
Mat2b T A 11: 40,570,869 (GRCm39) R318S probably damaging Het
Mgat4d G A 8: 84,094,837 (GRCm39) probably null Het
Mtor T A 4: 148,641,312 (GRCm39) probably null Het
Nostrin A T 2: 69,006,057 (GRCm39) Q247L possibly damaging Het
Obi1 C T 14: 104,745,466 (GRCm39) G70E probably damaging Het
Obscn T C 11: 58,964,443 (GRCm39) E3033G probably damaging Het
Pam C A 1: 97,749,642 (GRCm39) D839Y probably damaging Het
Pds5a A G 5: 65,795,157 (GRCm39) V693A probably damaging Het
Pigo A T 4: 43,021,337 (GRCm39) L535Q probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Ptar1 G T 19: 23,671,729 (GRCm39) R44L probably damaging Het
Rad51c T C 11: 87,288,580 (GRCm39) H201R probably benign Het
Rims2 A T 15: 39,381,265 (GRCm39) probably null Het
Rpl22l1 T G 3: 28,860,985 (GRCm39) S67A possibly damaging Het
Rps10 A G 17: 27,849,454 (GRCm39) S143P probably damaging Het
Rundc1 T C 11: 101,315,967 (GRCm39) V13A probably benign Het
Sephs2 C A 7: 126,872,564 (GRCm39) M176I probably benign Het
Serpina16 C T 12: 103,641,189 (GRCm39) V179I probably benign Het
Serpini2 T A 3: 75,166,784 (GRCm39) T158S probably damaging Het
Slc12a3 A G 8: 95,072,979 (GRCm39) R701G probably damaging Het
Slc1a6 A G 10: 78,650,436 (GRCm39) E558G probably damaging Het
Ssx2ip T C 3: 146,136,672 (GRCm39) probably benign Het
Tbr1 A T 2: 61,636,346 (GRCm39) I241F possibly damaging Het
Tgfa G C 6: 86,247,064 (GRCm39) probably null Het
Tlr12 T A 4: 128,511,063 (GRCm39) K396* probably null Het
Tmppe A G 9: 114,235,026 (GRCm39) I442V probably benign Het
Tubb3 T C 8: 124,147,607 (GRCm39) V180A probably damaging Het
Vmn1r222 A G 13: 23,416,901 (GRCm39) V104A probably damaging Het
Vmn2r95 G T 17: 18,671,708 (GRCm39) V482L possibly damaging Het
Zfp184 G T 13: 22,143,452 (GRCm39) R386L possibly damaging Het
Zfp444 T A 7: 6,192,792 (GRCm39) V270E probably damaging Het
Zfp985 A T 4: 147,667,438 (GRCm39) Y102F probably damaging Het
Other mutations in Adam28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Adam28 APN 14 68,859,569 (GRCm39) missense possibly damaging 0.47
IGL00654:Adam28 APN 14 68,886,877 (GRCm39) missense probably benign 0.00
IGL01021:Adam28 APN 14 68,879,563 (GRCm39) missense probably benign
IGL01099:Adam28 APN 14 68,874,778 (GRCm39) critical splice donor site probably null
IGL01349:Adam28 APN 14 68,848,455 (GRCm39) missense probably benign 0.01
IGL01744:Adam28 APN 14 68,844,956 (GRCm39) missense probably benign 0.07
IGL01805:Adam28 APN 14 68,879,540 (GRCm39) missense probably benign 0.09
IGL02007:Adam28 APN 14 68,870,668 (GRCm39) missense possibly damaging 0.69
IGL02828:Adam28 APN 14 68,884,319 (GRCm39) missense possibly damaging 0.46
IGL03180:Adam28 APN 14 68,874,883 (GRCm39) missense probably damaging 1.00
IGL03355:Adam28 APN 14 68,872,252 (GRCm39) splice site probably benign
IGL02980:Adam28 UTSW 14 68,857,255 (GRCm39) missense probably benign 0.01
PIT4453001:Adam28 UTSW 14 68,872,325 (GRCm39) missense probably benign 0.00
R0184:Adam28 UTSW 14 68,874,822 (GRCm39) missense probably benign 0.33
R0321:Adam28 UTSW 14 68,855,200 (GRCm39) missense probably damaging 0.97
R0329:Adam28 UTSW 14 68,855,188 (GRCm39) missense probably damaging 0.96
R0494:Adam28 UTSW 14 68,868,241 (GRCm39) splice site probably benign
R0605:Adam28 UTSW 14 68,844,049 (GRCm39) unclassified probably benign
R0732:Adam28 UTSW 14 68,874,796 (GRCm39) missense probably benign 0.00
R0959:Adam28 UTSW 14 68,845,387 (GRCm39) missense possibly damaging 0.93
R1319:Adam28 UTSW 14 68,846,578 (GRCm39) missense probably benign 0.28
R1745:Adam28 UTSW 14 68,870,620 (GRCm39) missense probably benign 0.04
R1836:Adam28 UTSW 14 68,886,870 (GRCm39) missense possibly damaging 0.85
R1838:Adam28 UTSW 14 68,876,659 (GRCm39) missense possibly damaging 0.53
R1839:Adam28 UTSW 14 68,876,659 (GRCm39) missense possibly damaging 0.53
R1850:Adam28 UTSW 14 68,876,644 (GRCm39) missense probably benign 0.01
R1912:Adam28 UTSW 14 68,881,780 (GRCm39) missense probably benign 0.24
R2830:Adam28 UTSW 14 68,864,363 (GRCm39) missense possibly damaging 0.65
R2889:Adam28 UTSW 14 68,872,294 (GRCm39) missense possibly damaging 0.85
R3977:Adam28 UTSW 14 68,848,443 (GRCm39) missense probably benign 0.20
R3978:Adam28 UTSW 14 68,848,443 (GRCm39) missense probably benign 0.20
R3979:Adam28 UTSW 14 68,848,443 (GRCm39) missense probably benign 0.20
R4282:Adam28 UTSW 14 68,885,155 (GRCm39) missense possibly damaging 0.92
R4416:Adam28 UTSW 14 68,859,531 (GRCm39) critical splice donor site probably null
R4690:Adam28 UTSW 14 68,879,497 (GRCm39) missense probably benign 0.01
R4724:Adam28 UTSW 14 68,864,326 (GRCm39) missense probably damaging 0.99
R4768:Adam28 UTSW 14 68,872,264 (GRCm39) missense possibly damaging 0.46
R4883:Adam28 UTSW 14 68,875,552 (GRCm39) missense probably damaging 0.99
R5710:Adam28 UTSW 14 68,847,357 (GRCm39) missense probably damaging 0.96
R5835:Adam28 UTSW 14 68,893,130 (GRCm39) missense possibly damaging 0.96
R6002:Adam28 UTSW 14 68,879,511 (GRCm39) missense probably benign
R6054:Adam28 UTSW 14 68,879,601 (GRCm39) missense probably benign 0.01
R6349:Adam28 UTSW 14 68,870,621 (GRCm39) missense probably benign 0.29
R6449:Adam28 UTSW 14 68,868,116 (GRCm39) missense probably benign 0.31
R6455:Adam28 UTSW 14 68,870,657 (GRCm39) missense probably damaging 1.00
R6831:Adam28 UTSW 14 68,855,576 (GRCm39) missense probably benign 0.04
R6833:Adam28 UTSW 14 68,855,576 (GRCm39) missense probably benign 0.04
R7212:Adam28 UTSW 14 68,874,846 (GRCm39) missense probably damaging 0.99
R7411:Adam28 UTSW 14 68,864,396 (GRCm39) missense probably damaging 1.00
R7422:Adam28 UTSW 14 68,864,326 (GRCm39) missense probably damaging 1.00
R7516:Adam28 UTSW 14 68,868,125 (GRCm39) missense probably damaging 1.00
R7649:Adam28 UTSW 14 68,872,282 (GRCm39) missense probably benign 0.12
R7765:Adam28 UTSW 14 68,846,555 (GRCm39) critical splice donor site probably null
R8469:Adam28 UTSW 14 68,844,029 (GRCm39) missense probably benign 0.16
R8520:Adam28 UTSW 14 68,879,532 (GRCm39) missense probably damaging 0.98
R9026:Adam28 UTSW 14 68,846,593 (GRCm39) missense probably benign 0.16
R9163:Adam28 UTSW 14 68,866,531 (GRCm39) missense probably damaging 0.98
R9264:Adam28 UTSW 14 68,844,914 (GRCm39) missense probably benign
R9304:Adam28 UTSW 14 68,874,946 (GRCm39) missense probably damaging 1.00
R9357:Adam28 UTSW 14 68,879,479 (GRCm39) missense probably benign 0.36
R9441:Adam28 UTSW 14 68,874,943 (GRCm39) missense probably damaging 0.96
Z1177:Adam28 UTSW 14 68,864,233 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTTGATATTTGGCAAAGAGAGA -3'
(R):5'- GCCAACAAAGCAGGGGTCT -3'

Sequencing Primer
(F):5'- GCATCAACGTGACCAGTTGTC -3'
(R):5'- AGGGGTCTCTCTCATGTCAAAAC -3'
Posted On 2016-06-06