Incidental Mutation 'R5054:Vmn2r95'
ID 390736
Institutional Source Beutler Lab
Gene Symbol Vmn2r95
Ensembl Gene ENSMUSG00000091631
Gene Name vomeronasal 2, receptor 95
Synonyms
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 18644366-18672586 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 18671708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 482 (V482L)
Ref Sequence ENSEMBL: ENSMUSP00000156383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166327] [ENSMUST00000232090] [ENSMUST00000232464]
AlphaFold A0A338P6T0
Predicted Effect probably benign
Transcript: ENSMUST00000166327
SMART Domains Protein: ENSMUSP00000126106
Gene: ENSMUSG00000091631

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 462 1.8e-35 PFAM
Pfam:NCD3G 509 562 3.2e-20 PFAM
Pfam:7tm_3 594 830 3.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232090
AA Change: V554L

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232464
AA Change: V482L

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,837,315 (GRCm39) Y257H probably damaging Het
Adam28 C T 14: 68,855,164 (GRCm39) C659Y probably damaging Het
Adamtsl2 G A 2: 26,991,732 (GRCm39) E627K probably damaging Het
Atad5 T A 11: 79,985,502 (GRCm39) S196R probably benign Het
Bcam T A 7: 19,490,785 (GRCm39) probably benign Het
Birc6 A G 17: 74,962,320 (GRCm39) H3978R probably damaging Het
Btbd7 T C 12: 102,804,471 (GRCm39) I190V probably benign Het
Ccdc8 T C 7: 16,728,970 (GRCm39) V153A probably damaging Het
Cyp2a5 C G 7: 26,540,529 (GRCm39) R68G probably damaging Het
Dock3 T C 9: 106,815,105 (GRCm39) Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 (GRCm39) E2794G possibly damaging Het
Dytn C A 1: 63,700,318 (GRCm39) V271L possibly damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif2s2 A C 2: 154,734,590 (GRCm39) probably null Het
Fndc7 A G 3: 108,788,663 (GRCm39) S193P probably damaging Het
Fzr1 G A 10: 81,207,253 (GRCm39) probably benign Het
Gm17472 T C 6: 42,957,938 (GRCm39) I69T probably damaging Het
Gmppa C A 1: 75,416,015 (GRCm39) Y137* probably null Het
Gpr45 A G 1: 43,071,809 (GRCm39) I151V probably benign Het
H1f0 G A 15: 78,912,973 (GRCm39) A18T probably damaging Het
Hbb-bh1 C T 7: 103,491,063 (GRCm39) V114I probably benign Het
Impa2 C A 18: 67,439,797 (GRCm39) P98Q probably damaging Het
Kazn T C 4: 141,835,957 (GRCm39) N573D unknown Het
Kcna2 A T 3: 107,011,656 (GRCm39) D79V probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kif13a A G 13: 46,956,122 (GRCm39) Y561H probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klra1 T A 6: 130,352,247 (GRCm39) Q165L probably damaging Het
Mat2b T A 11: 40,570,869 (GRCm39) R318S probably damaging Het
Mgat4d G A 8: 84,094,837 (GRCm39) probably null Het
Mtor T A 4: 148,641,312 (GRCm39) probably null Het
Nostrin A T 2: 69,006,057 (GRCm39) Q247L possibly damaging Het
Obi1 C T 14: 104,745,466 (GRCm39) G70E probably damaging Het
Obscn T C 11: 58,964,443 (GRCm39) E3033G probably damaging Het
Pam C A 1: 97,749,642 (GRCm39) D839Y probably damaging Het
Pds5a A G 5: 65,795,157 (GRCm39) V693A probably damaging Het
Pigo A T 4: 43,021,337 (GRCm39) L535Q probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Ptar1 G T 19: 23,671,729 (GRCm39) R44L probably damaging Het
Rad51c T C 11: 87,288,580 (GRCm39) H201R probably benign Het
Rims2 A T 15: 39,381,265 (GRCm39) probably null Het
Rpl22l1 T G 3: 28,860,985 (GRCm39) S67A possibly damaging Het
Rps10 A G 17: 27,849,454 (GRCm39) S143P probably damaging Het
Rundc1 T C 11: 101,315,967 (GRCm39) V13A probably benign Het
Sephs2 C A 7: 126,872,564 (GRCm39) M176I probably benign Het
Serpina16 C T 12: 103,641,189 (GRCm39) V179I probably benign Het
Serpini2 T A 3: 75,166,784 (GRCm39) T158S probably damaging Het
Slc12a3 A G 8: 95,072,979 (GRCm39) R701G probably damaging Het
Slc1a6 A G 10: 78,650,436 (GRCm39) E558G probably damaging Het
Ssx2ip T C 3: 146,136,672 (GRCm39) probably benign Het
Tbr1 A T 2: 61,636,346 (GRCm39) I241F possibly damaging Het
Tgfa G C 6: 86,247,064 (GRCm39) probably null Het
Tlr12 T A 4: 128,511,063 (GRCm39) K396* probably null Het
Tmppe A G 9: 114,235,026 (GRCm39) I442V probably benign Het
Tubb3 T C 8: 124,147,607 (GRCm39) V180A probably damaging Het
Vmn1r222 A G 13: 23,416,901 (GRCm39) V104A probably damaging Het
Zfp184 G T 13: 22,143,452 (GRCm39) R386L possibly damaging Het
Zfp444 T A 7: 6,192,792 (GRCm39) V270E probably damaging Het
Zfp985 A T 4: 147,667,438 (GRCm39) Y102F probably damaging Het
Other mutations in Vmn2r95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Vmn2r95 APN 17 18,672,590 (GRCm39) utr 3 prime probably benign
IGL01479:Vmn2r95 APN 17 18,664,124 (GRCm39) missense probably damaging 1.00
IGL01890:Vmn2r95 APN 17 18,671,737 (GRCm39) missense probably damaging 1.00
IGL01986:Vmn2r95 APN 17 18,660,473 (GRCm39) missense probably benign 0.06
IGL02113:Vmn2r95 APN 17 18,660,169 (GRCm39) missense possibly damaging 0.47
IGL02154:Vmn2r95 APN 17 18,672,248 (GRCm39) missense probably benign 0.16
IGL02190:Vmn2r95 APN 17 18,672,038 (GRCm39) missense probably benign 0.00
IGL02412:Vmn2r95 APN 17 18,660,218 (GRCm39) missense probably damaging 1.00
IGL02550:Vmn2r95 APN 17 18,671,994 (GRCm39) missense probably damaging 1.00
IGL02679:Vmn2r95 APN 17 18,664,116 (GRCm39) missense probably damaging 1.00
IGL02691:Vmn2r95 APN 17 18,672,120 (GRCm39) missense probably benign 0.07
IGL02990:Vmn2r95 APN 17 18,672,298 (GRCm39) nonsense probably null
IGL03032:Vmn2r95 APN 17 18,672,575 (GRCm39) missense probably benign 0.00
R0416:Vmn2r95 UTSW 17 18,661,664 (GRCm39) missense probably damaging 1.00
R0448:Vmn2r95 UTSW 17 18,672,005 (GRCm39) missense possibly damaging 0.92
R0514:Vmn2r95 UTSW 17 18,671,844 (GRCm39) missense probably benign
R0519:Vmn2r95 UTSW 17 18,659,765 (GRCm39) missense probably damaging 1.00
R0539:Vmn2r95 UTSW 17 18,672,362 (GRCm39) missense probably damaging 1.00
R1501:Vmn2r95 UTSW 17 18,660,118 (GRCm39) missense probably damaging 0.99
R1598:Vmn2r95 UTSW 17 18,672,575 (GRCm39) missense probably benign 0.03
R1613:Vmn2r95 UTSW 17 18,660,901 (GRCm39) splice site probably benign
R1861:Vmn2r95 UTSW 17 18,672,530 (GRCm39) missense probably damaging 1.00
R1921:Vmn2r95 UTSW 17 18,644,575 (GRCm39) missense probably benign 0.11
R1986:Vmn2r95 UTSW 17 18,671,805 (GRCm39) missense probably benign
R2031:Vmn2r95 UTSW 17 18,659,717 (GRCm39) missense possibly damaging 0.94
R2040:Vmn2r95 UTSW 17 18,661,561 (GRCm39) missense probably damaging 1.00
R3608:Vmn2r95 UTSW 17 18,660,235 (GRCm39) missense possibly damaging 0.47
R3727:Vmn2r95 UTSW 17 18,661,744 (GRCm39) nonsense probably null
R3953:Vmn2r95 UTSW 17 18,660,358 (GRCm39) missense possibly damaging 0.79
R3955:Vmn2r95 UTSW 17 18,660,358 (GRCm39) missense possibly damaging 0.79
R3957:Vmn2r95 UTSW 17 18,660,358 (GRCm39) missense possibly damaging 0.79
R4474:Vmn2r95 UTSW 17 18,672,507 (GRCm39) missense probably damaging 1.00
R4672:Vmn2r95 UTSW 17 18,672,413 (GRCm39) missense probably damaging 1.00
R4850:Vmn2r95 UTSW 17 18,671,915 (GRCm39) missense probably damaging 1.00
R5178:Vmn2r95 UTSW 17 18,660,337 (GRCm39) missense probably benign 0.01
R5980:Vmn2r95 UTSW 17 18,661,624 (GRCm39) missense probably benign
R6183:Vmn2r95 UTSW 17 18,664,192 (GRCm39) missense probably damaging 0.99
R6276:Vmn2r95 UTSW 17 18,671,732 (GRCm39) missense possibly damaging 0.96
R6651:Vmn2r95 UTSW 17 18,660,622 (GRCm39) missense probably damaging 1.00
R6682:Vmn2r95 UTSW 17 18,660,489 (GRCm39) missense probably damaging 1.00
R6797:Vmn2r95 UTSW 17 18,672,551 (GRCm39) utr 3 prime probably benign
R6799:Vmn2r95 UTSW 17 18,659,555 (GRCm39) missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18,664,182 (GRCm39) missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18,664,181 (GRCm39) missense probably damaging 1.00
R6982:Vmn2r95 UTSW 17 18,672,323 (GRCm39) missense probably damaging 1.00
R7203:Vmn2r95 UTSW 17 18,661,577 (GRCm39) missense probably benign 0.01
R7226:Vmn2r95 UTSW 17 18,672,245 (GRCm39) missense possibly damaging 0.90
R7240:Vmn2r95 UTSW 17 18,672,225 (GRCm39) missense probably benign 0.15
R7383:Vmn2r95 UTSW 17 18,660,734 (GRCm39) missense probably benign 0.06
R7614:Vmn2r95 UTSW 17 18,660,352 (GRCm39) missense probably benign
R7755:Vmn2r95 UTSW 17 18,644,367 (GRCm39) start codon destroyed probably null 0.99
R7942:Vmn2r95 UTSW 17 18,660,529 (GRCm39) missense possibly damaging 0.74
R8355:Vmn2r95 UTSW 17 18,660,352 (GRCm39) missense probably benign
R8455:Vmn2r95 UTSW 17 18,660,352 (GRCm39) missense probably benign
R8478:Vmn2r95 UTSW 17 18,672,544 (GRCm39) missense probably damaging 1.00
R8547:Vmn2r95 UTSW 17 18,664,161 (GRCm39) missense probably damaging 1.00
R8752:Vmn2r95 UTSW 17 18,661,738 (GRCm39) missense probably damaging 0.98
R8788:Vmn2r95 UTSW 17 18,671,790 (GRCm39) missense probably benign 0.09
R8852:Vmn2r95 UTSW 17 18,664,113 (GRCm39) missense possibly damaging 0.95
R9098:Vmn2r95 UTSW 17 18,660,167 (GRCm39) missense possibly damaging 0.88
R9202:Vmn2r95 UTSW 17 18,644,394 (GRCm39) missense probably benign 0.00
R9244:Vmn2r95 UTSW 17 18,672,189 (GRCm39) missense possibly damaging 0.91
R9546:Vmn2r95 UTSW 17 18,661,721 (GRCm39) missense probably benign 0.01
R9665:Vmn2r95 UTSW 17 18,660,607 (GRCm39) missense probably damaging 0.99
Z1088:Vmn2r95 UTSW 17 18,660,663 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATGTAAGGAGCTCAAGGAGTTTTG -3'
(R):5'- CTGTGCTTCACAAAGATGCC -3'

Sequencing Primer
(F):5'- CTCAAGGAGTTTTGAGTAAAGACTG -3'
(R):5'- TGTGCTTCACAAAGATGCCAATAAC -3'
Posted On 2016-06-06