Incidental Mutation 'R5054:Rps10'
ID 390737
Institutional Source Beutler Lab
Gene Symbol Rps10
Ensembl Gene ENSMUSG00000052146
Gene Name ribosomal protein S10
Synonyms 2210402A09Rik
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 27849389-27854218 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27849454 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 143 (S143P)
Ref Sequence ENSEMBL: ENSMUSP00000025052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025052] [ENSMUST00000114881] [ENSMUST00000114882] [ENSMUST00000152982] [ENSMUST00000155071] [ENSMUST00000178774]
AlphaFold P63325
Predicted Effect probably damaging
Transcript: ENSMUST00000025052
AA Change: S143P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025052
Gene: ENSMUSG00000052146
AA Change: S143P

DomainStartEndE-ValueType
Pfam:S10_plectin 3 101 1.2e-48 PFAM
Predicted Effect silent
Transcript: ENSMUST00000114881
SMART Domains Protein: ENSMUSP00000110531
Gene: ENSMUSG00000052146

DomainStartEndE-ValueType
Pfam:S10_plectin 3 101 1.3e-48 PFAM
low complexity region 150 165 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000114882
SMART Domains Protein: ENSMUSP00000110532
Gene: ENSMUSG00000052146

DomainStartEndE-ValueType
Pfam:S10_plectin 3 98 2.3e-52 PFAM
low complexity region 150 165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150763
Predicted Effect probably benign
Transcript: ENSMUST00000152982
Predicted Effect probably benign
Transcript: ENSMUST00000155071
Predicted Effect silent
Transcript: ENSMUST00000178774
SMART Domains Protein: ENSMUSP00000136042
Gene: ENSMUSG00000052146

DomainStartEndE-ValueType
Pfam:S10_plectin 3 101 1.3e-48 PFAM
low complexity region 150 165 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S10E family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternate splicing results in multiple transcript variants that encode the same protein. Naturally occurring read-through transcription occurs between this locus and the neighboring locus NUDT3 (nudix (nucleoside diphosphate linked moiety X)-type motif 3).[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,837,315 (GRCm39) Y257H probably damaging Het
Adam28 C T 14: 68,855,164 (GRCm39) C659Y probably damaging Het
Adamtsl2 G A 2: 26,991,732 (GRCm39) E627K probably damaging Het
Atad5 T A 11: 79,985,502 (GRCm39) S196R probably benign Het
Bcam T A 7: 19,490,785 (GRCm39) probably benign Het
Birc6 A G 17: 74,962,320 (GRCm39) H3978R probably damaging Het
Btbd7 T C 12: 102,804,471 (GRCm39) I190V probably benign Het
Ccdc8 T C 7: 16,728,970 (GRCm39) V153A probably damaging Het
Cyp2a5 C G 7: 26,540,529 (GRCm39) R68G probably damaging Het
Dock3 T C 9: 106,815,105 (GRCm39) Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 (GRCm39) E2794G possibly damaging Het
Dytn C A 1: 63,700,318 (GRCm39) V271L possibly damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif2s2 A C 2: 154,734,590 (GRCm39) probably null Het
Fndc7 A G 3: 108,788,663 (GRCm39) S193P probably damaging Het
Fzr1 G A 10: 81,207,253 (GRCm39) probably benign Het
Gm17472 T C 6: 42,957,938 (GRCm39) I69T probably damaging Het
Gmppa C A 1: 75,416,015 (GRCm39) Y137* probably null Het
Gpr45 A G 1: 43,071,809 (GRCm39) I151V probably benign Het
H1f0 G A 15: 78,912,973 (GRCm39) A18T probably damaging Het
Hbb-bh1 C T 7: 103,491,063 (GRCm39) V114I probably benign Het
Impa2 C A 18: 67,439,797 (GRCm39) P98Q probably damaging Het
Kazn T C 4: 141,835,957 (GRCm39) N573D unknown Het
Kcna2 A T 3: 107,011,656 (GRCm39) D79V probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kif13a A G 13: 46,956,122 (GRCm39) Y561H probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klra1 T A 6: 130,352,247 (GRCm39) Q165L probably damaging Het
Mat2b T A 11: 40,570,869 (GRCm39) R318S probably damaging Het
Mgat4d G A 8: 84,094,837 (GRCm39) probably null Het
Mtor T A 4: 148,641,312 (GRCm39) probably null Het
Nostrin A T 2: 69,006,057 (GRCm39) Q247L possibly damaging Het
Obi1 C T 14: 104,745,466 (GRCm39) G70E probably damaging Het
Obscn T C 11: 58,964,443 (GRCm39) E3033G probably damaging Het
Pam C A 1: 97,749,642 (GRCm39) D839Y probably damaging Het
Pds5a A G 5: 65,795,157 (GRCm39) V693A probably damaging Het
Pigo A T 4: 43,021,337 (GRCm39) L535Q probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Ptar1 G T 19: 23,671,729 (GRCm39) R44L probably damaging Het
Rad51c T C 11: 87,288,580 (GRCm39) H201R probably benign Het
Rims2 A T 15: 39,381,265 (GRCm39) probably null Het
Rpl22l1 T G 3: 28,860,985 (GRCm39) S67A possibly damaging Het
Rundc1 T C 11: 101,315,967 (GRCm39) V13A probably benign Het
Sephs2 C A 7: 126,872,564 (GRCm39) M176I probably benign Het
Serpina16 C T 12: 103,641,189 (GRCm39) V179I probably benign Het
Serpini2 T A 3: 75,166,784 (GRCm39) T158S probably damaging Het
Slc12a3 A G 8: 95,072,979 (GRCm39) R701G probably damaging Het
Slc1a6 A G 10: 78,650,436 (GRCm39) E558G probably damaging Het
Ssx2ip T C 3: 146,136,672 (GRCm39) probably benign Het
Tbr1 A T 2: 61,636,346 (GRCm39) I241F possibly damaging Het
Tgfa G C 6: 86,247,064 (GRCm39) probably null Het
Tlr12 T A 4: 128,511,063 (GRCm39) K396* probably null Het
Tmppe A G 9: 114,235,026 (GRCm39) I442V probably benign Het
Tubb3 T C 8: 124,147,607 (GRCm39) V180A probably damaging Het
Vmn1r222 A G 13: 23,416,901 (GRCm39) V104A probably damaging Het
Vmn2r95 G T 17: 18,671,708 (GRCm39) V482L possibly damaging Het
Zfp184 G T 13: 22,143,452 (GRCm39) R386L possibly damaging Het
Zfp444 T A 7: 6,192,792 (GRCm39) V270E probably damaging Het
Zfp985 A T 4: 147,667,438 (GRCm39) Y102F probably damaging Het
Other mutations in Rps10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1509:Rps10 UTSW 17 27,850,182 (GRCm39) missense probably benign 0.06
R2213:Rps10 UTSW 17 27,849,473 (GRCm39) unclassified probably benign
R2344:Rps10 UTSW 17 27,853,081 (GRCm39) missense possibly damaging 0.93
R8163:Rps10 UTSW 17 27,853,085 (GRCm39) missense probably benign 0.00
R8462:Rps10 UTSW 17 27,853,208 (GRCm39) missense probably damaging 1.00
R9619:Rps10 UTSW 17 27,849,459 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTCACAAACCCTGACAGCTG -3'
(R):5'- GCCTTAAAGGTTTAACAGTGGG -3'

Sequencing Primer
(F):5'- TGAACCCACTCTGCAGGGAG -3'
(R):5'- GTTTAACAGTGGGAAACAGACTC -3'
Posted On 2016-06-06