Incidental Mutation 'R5054:Rps10'
ID 390737
Institutional Source Beutler Lab
Gene Symbol Rps10
Ensembl Gene ENSMUSG00000052146
Gene Name ribosomal protein S10
Synonyms
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 27630418-27636669 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27630480 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 143 (S143P)
Ref Sequence ENSEMBL: ENSMUSP00000025052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025052] [ENSMUST00000114881] [ENSMUST00000114882] [ENSMUST00000152982] [ENSMUST00000155071] [ENSMUST00000178774]
AlphaFold P63325
Predicted Effect probably damaging
Transcript: ENSMUST00000025052
AA Change: S143P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025052
Gene: ENSMUSG00000052146
AA Change: S143P

DomainStartEndE-ValueType
Pfam:S10_plectin 3 101 1.2e-48 PFAM
Predicted Effect silent
Transcript: ENSMUST00000114881
SMART Domains Protein: ENSMUSP00000110531
Gene: ENSMUSG00000052146

DomainStartEndE-ValueType
Pfam:S10_plectin 3 101 1.3e-48 PFAM
low complexity region 150 165 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000114882
SMART Domains Protein: ENSMUSP00000110532
Gene: ENSMUSG00000052146

DomainStartEndE-ValueType
Pfam:S10_plectin 3 98 2.3e-52 PFAM
low complexity region 150 165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150763
Predicted Effect probably benign
Transcript: ENSMUST00000152982
Predicted Effect probably benign
Transcript: ENSMUST00000155071
Predicted Effect silent
Transcript: ENSMUST00000178774
SMART Domains Protein: ENSMUSP00000136042
Gene: ENSMUSG00000052146

DomainStartEndE-ValueType
Pfam:S10_plectin 3 101 1.3e-48 PFAM
low complexity region 150 165 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S10E family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternate splicing results in multiple transcript variants that encode the same protein. Naturally occurring read-through transcription occurs between this locus and the neighboring locus NUDT3 (nudix (nucleoside diphosphate linked moiety X)-type motif 3).[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,689,501 Y257H probably damaging Het
Adam28 C T 14: 68,617,715 C659Y probably damaging Het
Adamtsl2 G A 2: 27,101,720 E627K probably damaging Het
Atad5 T A 11: 80,094,676 S196R probably benign Het
Bcam T A 7: 19,756,860 probably benign Het
Birc6 A G 17: 74,655,325 H3978R probably damaging Het
Btbd7 T C 12: 102,838,212 I190V probably benign Het
Ccdc8 T C 7: 16,995,045 V153A probably damaging Het
Cyp2a5 C G 7: 26,841,104 R68G probably damaging Het
Dock3 T C 9: 106,937,906 Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 E2794G possibly damaging Het
Dytn C A 1: 63,661,159 V271L possibly damaging Het
Eif2s2 A C 2: 154,892,670 probably null Het
Fndc7 A G 3: 108,881,347 S193P probably damaging Het
Fzr1 G A 10: 81,371,419 probably benign Het
Gm17472 T C 6: 42,981,004 I69T probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gmppa C A 1: 75,439,371 Y137* probably null Het
Gpr45 A G 1: 43,032,649 I151V probably benign Het
H1f0 G A 15: 79,028,773 A18T probably damaging Het
Hbb-bh1 C T 7: 103,841,856 V114I probably benign Het
Impa2 C A 18: 67,306,727 P98Q probably damaging Het
Kazn T C 4: 142,108,646 N573D unknown Het
Kcna2 A T 3: 107,104,340 D79V probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kif13a A G 13: 46,802,646 Y561H probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra1 T A 6: 130,375,284 Q165L probably damaging Het
Mat2b T A 11: 40,680,042 R318S probably damaging Het
Mgat4d G A 8: 83,368,208 probably null Het
Mtor T A 4: 148,556,855 probably null Het
Nostrin A T 2: 69,175,713 Q247L possibly damaging Het
Obscn T C 11: 59,073,617 E3033G probably damaging Het
Pam C A 1: 97,821,917 D839Y probably damaging Het
Pds5a A G 5: 65,637,814 V693A probably damaging Het
Pigo A T 4: 43,021,337 L535Q probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptar1 G T 19: 23,694,365 R44L probably damaging Het
Rad51c T C 11: 87,397,754 H201R probably benign Het
Rims2 A T 15: 39,517,869 probably null Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Rpl22l1 T G 3: 28,806,836 S67A possibly damaging Het
Rundc1 T C 11: 101,425,141 V13A probably benign Het
Sephs2 C A 7: 127,273,392 M176I probably benign Het
Serpina16 C T 12: 103,674,930 V179I probably benign Het
Serpini2 T A 3: 75,259,477 T158S probably damaging Het
Slc12a3 A G 8: 94,346,351 R701G probably damaging Het
Slc1a6 A G 10: 78,814,602 E558G probably damaging Het
Ssx2ip T C 3: 146,430,917 probably benign Het
Tbr1 A T 2: 61,806,002 I241F possibly damaging Het
Tgfa G C 6: 86,270,082 probably null Het
Tlr12 T A 4: 128,617,270 K396* probably null Het
Tmppe A G 9: 114,405,958 I442V probably benign Het
Tubb3 T C 8: 123,420,868 V180A probably damaging Het
Vmn1r222 A G 13: 23,232,731 V104A probably damaging Het
Vmn2r95 G T 17: 18,451,446 V482L possibly damaging Het
Zfp184 G T 13: 21,959,282 R386L possibly damaging Het
Zfp444 T A 7: 6,189,793 V270E probably damaging Het
Zfp985 A T 4: 147,582,981 Y102F probably damaging Het
Other mutations in Rps10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1509:Rps10 UTSW 17 27631208 missense probably benign 0.06
R2213:Rps10 UTSW 17 27630499 unclassified probably benign
R2344:Rps10 UTSW 17 27634107 missense possibly damaging 0.93
R8163:Rps10 UTSW 17 27634111 missense probably benign 0.00
R8462:Rps10 UTSW 17 27634234 missense probably damaging 1.00
R9619:Rps10 UTSW 17 27630485 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTCACAAACCCTGACAGCTG -3'
(R):5'- GCCTTAAAGGTTTAACAGTGGG -3'

Sequencing Primer
(F):5'- TGAACCCACTCTGCAGGGAG -3'
(R):5'- GTTTAACAGTGGGAAACAGACTC -3'
Posted On 2016-06-06