Incidental Mutation 'R5055:Nes'
ID390755
Institutional Source Beutler Lab
Gene Symbol Nes
Ensembl Gene ENSMUSG00000004891
Gene Namenestin
SynonymsESTM46
MMRRC Submission 042645-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.686) question?
Stock #R5055 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87971078-87980451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87977214 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 883 (N883D)
Ref Sequence ENSEMBL: ENSMUSP00000125571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090973] [ENSMUST00000160694]
Predicted Effect probably benign
Transcript: ENSMUST00000090973
AA Change: N927D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088493
Gene: ENSMUSG00000004891
AA Change: N927D

DomainStartEndE-ValueType
Filament 7 313 1.81e-37 SMART
low complexity region 439 448 N/A INTRINSIC
internal_repeat_2 470 771 2.37e-7 PROSPERO
internal_repeat_1 614 832 5.41e-11 PROSPERO
internal_repeat_2 851 1174 2.37e-7 PROSPERO
internal_repeat_1 1064 1304 5.41e-11 PROSPERO
low complexity region 1347 1366 N/A INTRINSIC
low complexity region 1426 1438 N/A INTRINSIC
low complexity region 1653 1683 N/A INTRINSIC
low complexity region 1713 1724 N/A INTRINSIC
low complexity region 1741 1760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159830
Predicted Effect probably benign
Transcript: ENSMUST00000160694
AA Change: N883D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125571
Gene: ENSMUSG00000004891
AA Change: N883D

DomainStartEndE-ValueType
Pfam:Filament 7 313 3.5e-29 PFAM
low complexity region 439 448 N/A INTRINSIC
internal_repeat_2 456 672 1.06e-5 PROSPERO
internal_repeat_1 470 798 1.21e-11 PROSPERO
internal_repeat_1 807 1134 1.21e-11 PROSPERO
internal_repeat_2 1024 1213 1.06e-5 PROSPERO
low complexity region 1303 1322 N/A INTRINSIC
low complexity region 1382 1394 N/A INTRINSIC
low complexity region 1609 1639 N/A INTRINSIC
low complexity region 1669 1680 N/A INTRINSIC
low complexity region 1697 1716 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (84/86)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display a high incidence of embryonic lethality, reduced embryo and birth body size, and fewer neural stem cells and increased apoptosis in the neuroepithelium of the developing neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 G A 11: 46,123,169 V329I probably damaging Het
Adgrl3 C A 5: 81,646,551 A541E possibly damaging Het
Agbl1 A T 7: 76,413,577 I263F probably damaging Het
Ash1l T C 3: 89,023,212 probably null Het
BC051142 G A 17: 34,448,796 C154Y possibly damaging Het
Bccip A G 7: 133,714,923 T91A probably benign Het
Bnc1 A T 7: 81,974,415 F355I probably damaging Het
Bpifa2 A T 2: 154,013,710 D185V probably damaging Het
Capn8 T A 1: 182,571,961 V89D probably damaging Het
Cfap46 A T 7: 139,661,190 M421K probably damaging Het
Chd2 A T 7: 73,480,508 L800M probably damaging Het
Chd4 A G 6: 125,100,986 D137G possibly damaging Het
Crtap A G 9: 114,390,140 Y154H probably benign Het
Ctdp1 T A 18: 80,456,088 Q213L probably damaging Het
Cts6 T C 13: 61,196,350 Y296C probably damaging Het
Daxx G T 17: 33,912,160 V354F probably benign Het
Dnah2 A G 11: 69,520,773 I341T possibly damaging Het
Epha2 A G 4: 141,309,069 D272G probably benign Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fbxl7 C A 15: 26,552,936 G82W probably damaging Het
Fcamr G A 1: 130,811,437 C158Y probably damaging Het
Fyb A C 15: 6,585,149 probably benign Het
Gars G A 6: 55,068,092 R454H probably damaging Het
Ghsr T C 3: 27,372,272 V159A probably benign Het
Glp1r A T 17: 30,918,887 Q97H probably benign Het
Gm27047 T C 6: 130,629,946 noncoding transcript Het
Igkv3-3 A C 6: 70,687,239 I22L probably benign Het
Inpp5b G T 4: 124,743,031 probably null Het
Ipo9 C A 1: 135,402,359 E448* probably null Het
Itgb2l A T 16: 96,427,803 I400N probably damaging Het
Kat6b T A 14: 21,516,994 H40Q probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnq2 G T 2: 181,086,761 probably benign Het
Klf7 T C 1: 64,079,280 T53A probably benign Het
Kmt2a A G 9: 44,818,352 probably benign Het
Lrp10 C T 14: 54,468,345 R331C probably benign Het
Map4k5 A T 12: 69,831,558 D289E probably benign Het
Mfsd4b2 A T 10: 39,923,777 M43K possibly damaging Het
Msr1 T G 8: 39,623,956 R138S possibly damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Myh9 G A 15: 77,764,523 A1711V probably benign Het
Myo18b A G 5: 112,875,217 probably benign Het
Nampt A T 12: 32,833,121 N102Y possibly damaging Het
Nell2 T C 15: 95,473,579 I92V probably benign Het
Neurl3 T A 1: 36,273,382 probably benign Het
Ocln T A 13: 100,539,422 T188S probably benign Het
Olfr1023 T C 2: 85,887,241 F147S probably benign Het
Olfr704 T A 7: 106,865,730 M250K probably damaging Het
Parp14 T A 16: 35,844,363 Q1305L probably benign Het
Pde3a C T 6: 141,487,956 Q855* probably null Het
Pde4b T C 4: 102,195,114 probably benign Het
Pdk2 T C 11: 95,039,416 M65V probably benign Het
Phf21a T C 2: 92,351,856 S377P probably damaging Het
Plcb2 T A 2: 118,718,222 T408S probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ppp6r2 A G 15: 89,282,949 D789G probably benign Het
Prdm16 T C 4: 154,335,262 M897V possibly damaging Het
Prss57 A G 10: 79,784,344 probably null Het
Psd G T 19: 46,322,468 L381I probably benign Het
Ptprq A T 10: 107,534,679 D2050E probably benign Het
Rfc1 G T 5: 65,266,162 N1034K probably damaging Het
Ryr3 C T 2: 112,831,159 G1829S probably benign Het
Scaper T C 9: 55,859,719 probably null Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Slc28a1 A G 7: 81,169,048 N583S possibly damaging Het
Slc35e3 C T 10: 117,744,979 G140D probably damaging Het
Slc6a9 G A 4: 117,868,150 probably null Het
Sptlc1 A G 13: 53,342,182 S376P probably benign Het
Sspo G A 6: 48,464,795 C1913Y probably damaging Het
Taar7b A T 10: 24,000,947 I337F possibly damaging Het
Tdpoz2 T A 3: 93,651,928 I246F probably damaging Het
Trpa1 C T 1: 14,875,959 V983M probably damaging Het
Trpm5 A T 7: 143,072,784 M1112K probably benign Het
Uso1 A T 5: 92,192,735 K670I probably benign Het
Washc4 A G 10: 83,556,907 D257G probably damaging Het
Wdr41 T A 13: 95,015,217 probably null Het
Zbtb17 A G 4: 141,466,549 Q668R possibly damaging Het
Other mutations in Nes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Nes APN 3 87976254 nonsense probably null
IGL01532:Nes APN 3 87978347 missense possibly damaging 0.54
IGL01544:Nes APN 3 87977964 missense possibly damaging 0.93
IGL02609:Nes APN 3 87977221 missense probably benign 0.33
IGL02877:Nes APN 3 87975661 missense probably benign 0.04
IGL02937:Nes APN 3 87979879 missense probably benign
R0271:Nes UTSW 3 87978642 missense possibly damaging 0.91
R0587:Nes UTSW 3 87978569 missense probably benign 0.08
R0625:Nes UTSW 3 87977172 missense possibly damaging 0.91
R0741:Nes UTSW 3 87978967 missense probably damaging 0.98
R1256:Nes UTSW 3 87976576 missense probably benign
R1630:Nes UTSW 3 87977677 missense probably benign 0.32
R1702:Nes UTSW 3 87975979 missense probably benign 0.04
R1724:Nes UTSW 3 87977441 missense probably benign
R1738:Nes UTSW 3 87976421 nonsense probably null
R1853:Nes UTSW 3 87975807 missense possibly damaging 0.91
R1946:Nes UTSW 3 87978514 missense possibly damaging 0.79
R1971:Nes UTSW 3 87978327 missense possibly damaging 0.81
R2013:Nes UTSW 3 87976678 missense possibly damaging 0.51
R2111:Nes UTSW 3 87977311 missense probably benign 0.04
R2232:Nes UTSW 3 87978931 missense possibly damaging 0.93
R2392:Nes UTSW 3 87975943 missense probably benign 0.08
R3548:Nes UTSW 3 87973122 splice site probably benign
R3937:Nes UTSW 3 87971236 missense probably benign 0.02
R4239:Nes UTSW 3 87979359 missense probably damaging 1.00
R4240:Nes UTSW 3 87979359 missense probably damaging 1.00
R4426:Nes UTSW 3 87976042 missense probably damaging 0.96
R4493:Nes UTSW 3 87976813 missense probably damaging 0.96
R4494:Nes UTSW 3 87976813 missense probably damaging 0.96
R4674:Nes UTSW 3 87971795 missense possibly damaging 0.51
R4772:Nes UTSW 3 87976179 missense probably benign 0.02
R4959:Nes UTSW 3 87975676 missense probably damaging 0.99
R4973:Nes UTSW 3 87975676 missense probably damaging 0.99
R5207:Nes UTSW 3 87978628 missense probably damaging 1.00
R5289:Nes UTSW 3 87978418 missense probably damaging 0.98
R5420:Nes UTSW 3 87977002 missense probably damaging 0.99
R5424:Nes UTSW 3 87978824 missense possibly damaging 0.94
R5697:Nes UTSW 3 87977848 missense probably damaging 0.96
R5940:Nes UTSW 3 87975952 missense probably damaging 0.99
R6661:Nes UTSW 3 87976936 missense probably damaging 0.96
R6905:Nes UTSW 3 87978678 missense probably damaging 0.99
R7087:Nes UTSW 3 87979758 missense probably benign 0.00
R7356:Nes UTSW 3 87977751 missense possibly damaging 0.93
R7810:Nes UTSW 3 87975616 missense probably benign 0.02
R8039:Nes UTSW 3 87977008 missense probably benign 0.00
R8401:Nes UTSW 3 87978081 missense possibly damaging 0.73
R8486:Nes UTSW 3 87980013 missense probably damaging 0.96
R8897:Nes UTSW 3 87979346 missense possibly damaging 0.53
X0019:Nes UTSW 3 87977418 missense probably benign 0.15
X0062:Nes UTSW 3 87977726 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCCACTGAGATCTCTAGAAG -3'
(R):5'- CTTTCACCACAGAGCTCAGTG -3'

Sequencing Primer
(F):5'- CCACTGAGATCTCTAGAAGTAGAAG -3'
(R):5'- ACAGAGCTCAGTGGGTCGTG -3'
Posted On2016-06-06