Incidental Mutation 'R5055:Pde4b'
ID390759
Institutional Source Beutler Lab
Gene Symbol Pde4b
Ensembl Gene ENSMUSG00000028525
Gene Namephosphodiesterase 4B, cAMP specific
Synonymsdunce, Dpde4
MMRRC Submission 042645-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R5055 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location102087543-102607259 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 102195114 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106911] [ENSMUST00000173119]
Predicted Effect probably benign
Transcript: ENSMUST00000106911
SMART Domains Protein: ENSMUSP00000102524
Gene: ENSMUSG00000028525

DomainStartEndE-ValueType
low complexity region 23 33 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
HDc 403 578 2.35e-5 SMART
low complexity region 685 698 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172845
Predicted Effect probably benign
Transcript: ENSMUST00000173119
SMART Domains Protein: ENSMUSP00000133413
Gene: ENSMUSG00000028525

DomainStartEndE-ValueType
low complexity region 23 33 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type IV, cyclic AMP (cAMP)-specific, cyclic nucleotide phosphodiesterase (PDE) family. The encoded protein regulates the cellular concentrations of cyclic nucleotides and thereby play a role in signal transduction. Altered activity of this protein has been associated with schizophrenia and bipolar affective disorder. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene produce significantly less TNF-alpha in response to lipopolysaccharide stimulation. One mutation resulted in brain and spinal cord vacuoles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 G A 11: 46,123,169 V329I probably damaging Het
Adgrl3 C A 5: 81,646,551 A541E possibly damaging Het
Agbl1 A T 7: 76,413,577 I263F probably damaging Het
Ash1l T C 3: 89,023,212 probably null Het
BC051142 G A 17: 34,448,796 C154Y possibly damaging Het
Bccip A G 7: 133,714,923 T91A probably benign Het
Bnc1 A T 7: 81,974,415 F355I probably damaging Het
Bpifa2 A T 2: 154,013,710 D185V probably damaging Het
Capn8 T A 1: 182,571,961 V89D probably damaging Het
Cfap46 A T 7: 139,661,190 M421K probably damaging Het
Chd2 A T 7: 73,480,508 L800M probably damaging Het
Chd4 A G 6: 125,100,986 D137G possibly damaging Het
Crtap A G 9: 114,390,140 Y154H probably benign Het
Ctdp1 T A 18: 80,456,088 Q213L probably damaging Het
Cts6 T C 13: 61,196,350 Y296C probably damaging Het
Daxx G T 17: 33,912,160 V354F probably benign Het
Dnah2 A G 11: 69,520,773 I341T possibly damaging Het
Epha2 A G 4: 141,309,069 D272G probably benign Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fbxl7 C A 15: 26,552,936 G82W probably damaging Het
Fcamr G A 1: 130,811,437 C158Y probably damaging Het
Fyb A C 15: 6,585,149 probably benign Het
Gars G A 6: 55,068,092 R454H probably damaging Het
Ghsr T C 3: 27,372,272 V159A probably benign Het
Glp1r A T 17: 30,918,887 Q97H probably benign Het
Gm27047 T C 6: 130,629,946 noncoding transcript Het
Igkv3-3 A C 6: 70,687,239 I22L probably benign Het
Inpp5b G T 4: 124,743,031 probably null Het
Ipo9 C A 1: 135,402,359 E448* probably null Het
Itgb2l A T 16: 96,427,803 I400N probably damaging Het
Kat6b T A 14: 21,516,994 H40Q probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnq2 G T 2: 181,086,761 probably benign Het
Klf7 T C 1: 64,079,280 T53A probably benign Het
Kmt2a A G 9: 44,818,352 probably benign Het
Lrp10 C T 14: 54,468,345 R331C probably benign Het
Map4k5 A T 12: 69,831,558 D289E probably benign Het
Mfsd4b2 A T 10: 39,923,777 M43K possibly damaging Het
Msr1 T G 8: 39,623,956 R138S possibly damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Myh9 G A 15: 77,764,523 A1711V probably benign Het
Myo18b A G 5: 112,875,217 probably benign Het
Nampt A T 12: 32,833,121 N102Y possibly damaging Het
Nell2 T C 15: 95,473,579 I92V probably benign Het
Nes A G 3: 87,977,214 N883D probably benign Het
Neurl3 T A 1: 36,273,382 probably benign Het
Ocln T A 13: 100,539,422 T188S probably benign Het
Olfr1023 T C 2: 85,887,241 F147S probably benign Het
Olfr704 T A 7: 106,865,730 M250K probably damaging Het
Parp14 T A 16: 35,844,363 Q1305L probably benign Het
Pde3a C T 6: 141,487,956 Q855* probably null Het
Pdk2 T C 11: 95,039,416 M65V probably benign Het
Phf21a T C 2: 92,351,856 S377P probably damaging Het
Plcb2 T A 2: 118,718,222 T408S probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ppp6r2 A G 15: 89,282,949 D789G probably benign Het
Prdm16 T C 4: 154,335,262 M897V possibly damaging Het
Prss57 A G 10: 79,784,344 probably null Het
Psd G T 19: 46,322,468 L381I probably benign Het
Ptprq A T 10: 107,534,679 D2050E probably benign Het
Rfc1 G T 5: 65,266,162 N1034K probably damaging Het
Ryr3 C T 2: 112,831,159 G1829S probably benign Het
Scaper T C 9: 55,859,719 probably null Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Slc28a1 A G 7: 81,169,048 N583S possibly damaging Het
Slc35e3 C T 10: 117,744,979 G140D probably damaging Het
Slc6a9 G A 4: 117,868,150 probably null Het
Sptlc1 A G 13: 53,342,182 S376P probably benign Het
Sspo G A 6: 48,464,795 C1913Y probably damaging Het
Taar7b A T 10: 24,000,947 I337F possibly damaging Het
Tdpoz2 T A 3: 93,651,928 I246F probably damaging Het
Trpa1 C T 1: 14,875,959 V983M probably damaging Het
Trpm5 A T 7: 143,072,784 M1112K probably benign Het
Uso1 A T 5: 92,192,735 K670I probably benign Het
Washc4 A G 10: 83,556,907 D257G probably damaging Het
Wdr41 T A 13: 95,015,217 probably null Het
Zbtb17 A G 4: 141,466,549 Q668R possibly damaging Het
Other mutations in Pde4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Pde4b APN 4 102506044 critical splice donor site probably null
IGL01146:Pde4b APN 4 102255263 missense possibly damaging 0.80
IGL01377:Pde4b APN 4 102487402 missense probably damaging 1.00
IGL01549:Pde4b APN 4 102605068 missense probably damaging 0.97
IGL01739:Pde4b APN 4 102601635 missense probably damaging 0.97
IGL01791:Pde4b APN 4 102590930 splice site probably benign
IGL02211:Pde4b APN 4 102590822 splice site probably benign
IGL02578:Pde4b APN 4 102255297 missense possibly damaging 0.94
IGL02878:Pde4b APN 4 102601639 missense probably damaging 1.00
PIT4458001:Pde4b UTSW 4 102602678 missense probably damaging 1.00
PIT4618001:Pde4b UTSW 4 102602812 missense probably benign 0.09
R0102:Pde4b UTSW 4 102590178 missense probably benign 0.15
R0230:Pde4b UTSW 4 102597510 missense probably benign 0.01
R0530:Pde4b UTSW 4 102602651 missense probably damaging 0.96
R0704:Pde4b UTSW 4 102487392 missense probably damaging 0.99
R1115:Pde4b UTSW 4 102542155 intron probably benign
R1450:Pde4b UTSW 4 102601635 missense probably damaging 0.97
R1457:Pde4b UTSW 4 102605176 missense probably damaging 0.99
R1568:Pde4b UTSW 4 102597699 missense probably damaging 1.00
R1740:Pde4b UTSW 4 102487351 missense probably damaging 1.00
R1784:Pde4b UTSW 4 102605260 missense probably benign 0.02
R1960:Pde4b UTSW 4 102597460 missense probably damaging 0.99
R1961:Pde4b UTSW 4 102597460 missense probably damaging 0.99
R2033:Pde4b UTSW 4 102605295 missense probably benign 0.43
R2210:Pde4b UTSW 4 102597475 missense probably damaging 1.00
R2848:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R2936:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R3195:Pde4b UTSW 4 102599643 missense probably damaging 0.99
R3196:Pde4b UTSW 4 102599643 missense probably damaging 0.99
R3695:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R3699:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R4014:Pde4b UTSW 4 102555625 missense probably benign 0.00
R4627:Pde4b UTSW 4 102601605 missense probably damaging 1.00
R4852:Pde4b UTSW 4 102597770 missense probably damaging 1.00
R5109:Pde4b UTSW 4 102601544 missense probably damaging 1.00
R5319:Pde4b UTSW 4 102421788 utr 3 prime probably benign
R5476:Pde4b UTSW 4 102602699 missense probably benign 0.00
R5576:Pde4b UTSW 4 102430162 missense probably damaging 0.98
R6019:Pde4b UTSW 4 102570769 missense possibly damaging 0.56
R6151:Pde4b UTSW 4 102601551 missense probably damaging 1.00
R6540:Pde4b UTSW 4 102601876 missense probably damaging 1.00
R6573:Pde4b UTSW 4 102430162 missense probably damaging 0.98
R6662:Pde4b UTSW 4 102601898 missense possibly damaging 0.82
R6751:Pde4b UTSW 4 102602671 missense probably damaging 0.98
R7066:Pde4b UTSW 4 102602806 missense probably benign 0.03
R7092:Pde4b UTSW 4 102601851 missense probably damaging 1.00
R7461:Pde4b UTSW 4 102255306 missense probably damaging 1.00
R7613:Pde4b UTSW 4 102255306 missense probably damaging 1.00
R8068:Pde4b UTSW 4 102596015 missense probably damaging 1.00
R8296:Pde4b UTSW 4 102602786 missense possibly damaging 0.76
R8732:Pde4b UTSW 4 102555625 missense probably null 0.00
Predicted Primers PCR Primer
(F):5'- CAGTTACACCCTCGGGATTGAC -3'
(R):5'- ATGTAAGGCATACTCCTTCCCC -3'

Sequencing Primer
(F):5'- CTGTTCAGGAAACTTACAGCTGC -3'
(R):5'- CCTCTTAAGAAGCAGATTTTCTTGC -3'
Posted On2016-06-06