Mutagenetix > Incidental Mutation

Incidental Mutation 'R5055:Pde4b'

390759

Institutional Source

Beutler Lab

Gene Symbol

Pde4b

Ensembl Gene

ENSMUSG00000028525

Gene Name

phosphodiesterase 4B, cAMP specific

Synonyms

dunce, Dpde4

MMRRC Submission

042645-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.575) question?

Stock #

R5055 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102087543-102607259 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 102195114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133413 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106911] [ENSMUST00000173119]

AlphaFold

B1AWC9

Predicted Effect

probably benign
Transcript: ENSMUST00000106911

SMART Domains

Protein: ENSMUSP00000102524
Gene: ENSMUSG00000028525

Domain	Start	End	E-Value	Type
low complexity region	23	33	N/A	INTRINSIC
low complexity region	74	83	N/A	INTRINSIC
HDc	403	578	2.35e-5	SMART
low complexity region	685	698	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172845

Predicted Effect

probably benign
Transcript: ENSMUST00000173119

SMART Domains

Protein: ENSMUSP00000133413
Gene: ENSMUSG00000028525

Domain	Start	End	E-Value	Type
low complexity region	23	33	N/A	INTRINSIC
low complexity region	74	83	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

98% (84/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type IV, cyclic AMP (cAMP)-specific, cyclic nucleotide phosphodiesterase (PDE) family. The encoded protein regulates the cellular concentrations of cyclic nucleotides and thereby play a role in signal transduction. Altered activity of this protein has been associated with schizophrenia and bipolar affective disorder. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene produce significantly less TNF-alpha in response to lipopolysaccharide stimulation. One mutation resulted in brain and spinal cord vacuoles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam19	G	A	11: 46,123,169	V329I	probably damaging	Het
Adgrl3	C	A	5: 81,646,551	A541E	possibly damaging	Het
Agbl1	A	T	7: 76,413,577	I263F	probably damaging	Het
Ash1l	T	C	3: 89,023,212		probably null	Het
BC051142	G	A	17: 34,448,796	C154Y	possibly damaging	Het
Bccip	A	G	7: 133,714,923	T91A	probably benign	Het
Bnc1	A	T	7: 81,974,415	F355I	probably damaging	Het
Bpifa2	A	T	2: 154,013,710	D185V	probably damaging	Het
Capn8	T	A	1: 182,571,961	V89D	probably damaging	Het
Cfap46	A	T	7: 139,661,190	M421K	probably damaging	Het
Chd2	A	T	7: 73,480,508	L800M	probably damaging	Het
Chd4	A	G	6: 125,100,986	D137G	possibly damaging	Het
Crtap	A	G	9: 114,390,140	Y154H	probably benign	Het
Ctdp1	T	A	18: 80,456,088	Q213L	probably damaging	Het
Cts6	T	C	13: 61,196,350	Y296C	probably damaging	Het
Daxx	G	T	17: 33,912,160	V354F	probably benign	Het
Dnah2	A	G	11: 69,520,773	I341T	possibly damaging	Het
Epha2	A	G	4: 141,309,069	D272G	probably benign	Het
Etfa	A	G	9: 55,500,133	V24A	probably damaging	Het
Fbxl7	C	A	15: 26,552,936	G82W	probably damaging	Het
Fcamr	G	A	1: 130,811,437	C158Y	probably damaging	Het
Fyb	A	C	15: 6,585,149		probably benign	Het
Gars	G	A	6: 55,068,092	R454H	probably damaging	Het
Ghsr	T	C	3: 27,372,272	V159A	probably benign	Het
Glp1r	A	T	17: 30,918,887	Q97H	probably benign	Het
Gm27047	T	C	6: 130,629,946		noncoding transcript	Het
Igkv3-3	A	C	6: 70,687,239	I22L	probably benign	Het
Inpp5b	G	T	4: 124,743,031		probably null	Het
Ipo9	C	A	1: 135,402,359	E448*	probably null	Het
Itgb2l	A	T	16: 96,427,803	I400N	probably damaging	Het
Kat6b	T	A	14: 21,516,994	H40Q	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kcnq2	G	T	2: 181,086,761		probably benign	Het
Klf7	T	C	1: 64,079,280	T53A	probably benign	Het
Kmt2a	A	G	9: 44,818,352		probably benign	Het
Lrp10	C	T	14: 54,468,345	R331C	probably benign	Het
Map4k5	A	T	12: 69,831,558	D289E	probably benign	Het
Mfsd4b2	A	T	10: 39,923,777	M43K	possibly damaging	Het
Msr1	T	G	8: 39,623,956	R138S	possibly damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Myh9	G	A	15: 77,764,523	A1711V	probably benign	Het
Myo18b	A	G	5: 112,875,217		probably benign	Het
Nampt	A	T	12: 32,833,121	N102Y	possibly damaging	Het
Nell2	T	C	15: 95,473,579	I92V	probably benign	Het
Nes	A	G	3: 87,977,214	N883D	probably benign	Het
Neurl3	T	A	1: 36,273,382		probably benign	Het
Ocln	T	A	13: 100,539,422	T188S	probably benign	Het
Olfr1023	T	C	2: 85,887,241	F147S	probably benign	Het
Olfr704	T	A	7: 106,865,730	M250K	probably damaging	Het
Parp14	T	A	16: 35,844,363	Q1305L	probably benign	Het
Pde3a	C	T	6: 141,487,956	Q855*	probably null	Het
Pdk2	T	C	11: 95,039,416	M65V	probably benign	Het
Phf21a	T	C	2: 92,351,856	S377P	probably damaging	Het
Plcb2	T	A	2: 118,718,222	T408S	probably benign	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ppp6r2	A	G	15: 89,282,949	D789G	probably benign	Het
Prdm16	T	C	4: 154,335,262	M897V	possibly damaging	Het
Prss57	A	G	10: 79,784,344		probably null	Het
Psd	G	T	19: 46,322,468	L381I	probably benign	Het
Ptprq	A	T	10: 107,534,679	D2050E	probably benign	Het
Rfc1	G	T	5: 65,266,162	N1034K	probably damaging	Het
Ryr3	C	T	2: 112,831,159	G1829S	probably benign	Het
Scaper	T	C	9: 55,859,719		probably null	Het
Scn5a	A	G	9: 119,522,566	I783T	probably damaging	Het
Slc28a1	A	G	7: 81,169,048	N583S	possibly damaging	Het
Slc35e3	C	T	10: 117,744,979	G140D	probably damaging	Het
Slc6a9	G	A	4: 117,868,150		probably null	Het
Sptlc1	A	G	13: 53,342,182	S376P	probably benign	Het
Sspo	G	A	6: 48,464,795	C1913Y	probably damaging	Het
Taar7b	A	T	10: 24,000,947	I337F	possibly damaging	Het
Tdpoz2	T	A	3: 93,651,928	I246F	probably damaging	Het
Trpa1	C	T	1: 14,875,959	V983M	probably damaging	Het
Trpm5	A	T	7: 143,072,784	M1112K	probably benign	Het
Uso1	A	T	5: 92,192,735	K670I	probably benign	Het
Washc4	A	G	10: 83,556,907	D257G	probably damaging	Het
Wdr41	T	A	13: 95,015,217		probably null	Het
Zbtb17	A	G	4: 141,466,549	Q668R	possibly damaging	Het

Other mutations in Pde4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Pde4b	APN	4	102506044	critical splice donor site	probably null
IGL01146:Pde4b	APN	4	102255263	missense	possibly damaging	0.80
IGL01377:Pde4b	APN	4	102487402	missense	probably damaging	1.00
IGL01549:Pde4b	APN	4	102605068	missense	probably damaging	0.97
IGL01739:Pde4b	APN	4	102601635	missense	probably damaging	0.97
IGL01791:Pde4b	APN	4	102590930	splice site	probably benign
IGL02211:Pde4b	APN	4	102590822	splice site	probably benign
IGL02578:Pde4b	APN	4	102255297	missense	possibly damaging	0.94
IGL02878:Pde4b	APN	4	102601639	missense	probably damaging	1.00
PIT4458001:Pde4b	UTSW	4	102602678	missense	probably damaging	1.00
PIT4618001:Pde4b	UTSW	4	102602812	missense	probably benign	0.09
R0102:Pde4b	UTSW	4	102590178	missense	probably benign	0.15
R0230:Pde4b	UTSW	4	102597510	missense	probably benign	0.01
R0530:Pde4b	UTSW	4	102602651	missense	probably damaging	0.96
R0704:Pde4b	UTSW	4	102487392	missense	probably damaging	0.99
R1115:Pde4b	UTSW	4	102542155	intron	probably benign
R1450:Pde4b	UTSW	4	102601635	missense	probably damaging	0.97
R1457:Pde4b	UTSW	4	102605176	missense	probably damaging	0.99
R1568:Pde4b	UTSW	4	102597699	missense	probably damaging	1.00
R1740:Pde4b	UTSW	4	102487351	missense	probably damaging	1.00
R1784:Pde4b	UTSW	4	102605260	missense	probably benign	0.02
R1960:Pde4b	UTSW	4	102597460	missense	probably damaging	0.99
R1961:Pde4b	UTSW	4	102597460	missense	probably damaging	0.99
R2033:Pde4b	UTSW	4	102605295	missense	probably benign	0.43
R2210:Pde4b	UTSW	4	102597475	missense	probably damaging	1.00
R2848:Pde4b	UTSW	4	102601545	missense	probably damaging	1.00
R2936:Pde4b	UTSW	4	102601545	missense	probably damaging	1.00
R3195:Pde4b	UTSW	4	102599643	missense	probably damaging	0.99
R3196:Pde4b	UTSW	4	102599643	missense	probably damaging	0.99
R3695:Pde4b	UTSW	4	102601545	missense	probably damaging	1.00
R3699:Pde4b	UTSW	4	102601545	missense	probably damaging	1.00
R4014:Pde4b	UTSW	4	102555625	missense	probably benign	0.00
R4627:Pde4b	UTSW	4	102601605	missense	probably damaging	1.00
R4852:Pde4b	UTSW	4	102597770	missense	probably damaging	1.00
R5109:Pde4b	UTSW	4	102601544	missense	probably damaging	1.00
R5319:Pde4b	UTSW	4	102421788	utr 3 prime	probably benign
R5476:Pde4b	UTSW	4	102602699	missense	probably benign	0.00
R5576:Pde4b	UTSW	4	102430162	missense	probably damaging	0.98
R6019:Pde4b	UTSW	4	102570769	missense	possibly damaging	0.56
R6151:Pde4b	UTSW	4	102601551	missense	probably damaging	1.00
R6540:Pde4b	UTSW	4	102601876	missense	probably damaging	1.00
R6573:Pde4b	UTSW	4	102430162	missense	probably damaging	0.98
R6662:Pde4b	UTSW	4	102601898	missense	possibly damaging	0.82
R6751:Pde4b	UTSW	4	102602671	missense	probably damaging	0.98
R7066:Pde4b	UTSW	4	102602806	missense	probably benign	0.03
R7092:Pde4b	UTSW	4	102601851	missense	probably damaging	1.00
R7461:Pde4b	UTSW	4	102255306	missense	probably damaging	1.00
R7613:Pde4b	UTSW	4	102255306	missense	probably damaging	1.00
R8068:Pde4b	UTSW	4	102596015	missense	probably damaging	1.00
R8296:Pde4b	UTSW	4	102602786	missense	possibly damaging	0.76
R8732:Pde4b	UTSW	4	102555625	missense	probably null	0.00
R9070:Pde4b	UTSW	4	102601797	missense	probably damaging	1.00
R9111:Pde4b	UTSW	4	102597460	missense	probably damaging	0.99
R9114:Pde4b	UTSW	4	102602629	missense	probably damaging	1.00
R9295:Pde4b	UTSW	4	102255281	missense	probably damaging	0.99
R9384:Pde4b	UTSW	4	102255251	missense	probably benign
R9516:Pde4b	UTSW	4	102604986	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTTACACCCTCGGGATTGAC -3'
(R):5'- ATGTAAGGCATACTCCTTCCCC -3'

Sequencing Primer
(F):5'- CTGTTCAGGAAACTTACAGCTGC -3'
(R):5'- CCTCTTAAGAAGCAGATTTTCTTGC -3'

Posted On

2016-06-06