Incidental Mutation 'R5055:Kmt2a'
ID390782
Institutional Source Beutler Lab
Gene Symbol Kmt2a
Ensembl Gene ENSMUSG00000002028
Gene Namelysine (K)-specific methyltransferase 2A
SynonymsMll1, HTRX1, ALL-1, Cxxc7, trithorax Drosophila, Mll, All1
MMRRC Submission 042645-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5055 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44803355-44881296 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 44818352 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000002095] [ENSMUST00000114689]
Predicted Effect unknown
Transcript: ENSMUST00000002095
AA Change: L3553S
SMART Domains Protein: ENSMUSP00000002095
Gene: ENSMUSG00000002028
AA Change: L3553S

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1624 7.94e-8 SMART
BROMO 1632 1766 2.24e-10 SMART
low complexity region 1816 1850 N/A INTRINSIC
PHD 1931 1977 1.74e-4 SMART
low complexity region 1990 2001 N/A INTRINSIC
FYRN 2029 2072 2.33e-20 SMART
low complexity region 2180 2194 N/A INTRINSIC
low complexity region 2215 2227 N/A INTRINSIC
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2789 2800 N/A INTRINSIC
low complexity region 2824 2833 N/A INTRINSIC
low complexity region 2856 2878 N/A INTRINSIC
low complexity region 2902 2909 N/A INTRINSIC
low complexity region 3115 3141 N/A INTRINSIC
low complexity region 3164 3175 N/A INTRINSIC
low complexity region 3228 3239 N/A INTRINSIC
low complexity region 3299 3312 N/A INTRINSIC
low complexity region 3342 3351 N/A INTRINSIC
low complexity region 3405 3419 N/A INTRINSIC
low complexity region 3498 3526 N/A INTRINSIC
low complexity region 3620 3633 N/A INTRINSIC
FYRC 3662 3747 8.54e-37 SMART
SET 3823 3945 6.09e-45 SMART
PostSET 3947 3963 1.65e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114689
AA Change: L3556S
SMART Domains Protein: ENSMUSP00000110337
Gene: ENSMUSG00000002028
AA Change: L3556S

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1627 9.12e-8 SMART
BROMO 1635 1769 2.24e-10 SMART
low complexity region 1819 1853 N/A INTRINSIC
PHD 1934 1980 1.74e-4 SMART
low complexity region 1993 2004 N/A INTRINSIC
FYRN 2032 2075 2.33e-20 SMART
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2218 2230 N/A INTRINSIC
low complexity region 2610 2621 N/A INTRINSIC
low complexity region 2792 2803 N/A INTRINSIC
low complexity region 2827 2836 N/A INTRINSIC
low complexity region 2859 2881 N/A INTRINSIC
low complexity region 2905 2912 N/A INTRINSIC
low complexity region 3118 3144 N/A INTRINSIC
low complexity region 3167 3178 N/A INTRINSIC
low complexity region 3231 3242 N/A INTRINSIC
low complexity region 3302 3315 N/A INTRINSIC
low complexity region 3345 3354 N/A INTRINSIC
low complexity region 3408 3422 N/A INTRINSIC
low complexity region 3501 3529 N/A INTRINSIC
low complexity region 3623 3636 N/A INTRINSIC
FYRC 3665 3750 8.54e-37 SMART
SET 3826 3948 6.09e-45 SMART
PostSET 3950 3966 1.65e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000138119
AA Change: L588S
Predicted Effect probably benign
Transcript: ENSMUST00000152241
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional coactivator that plays an essential role in regulating gene expression during early development and hematopoiesis. The encoded protein contains multiple conserved functional domains. One of these domains, the SET domain, is responsible for its histone H3 lysine 4 (H3K4) methyltransferase activity which mediates chromatin modifications associated with epigenetic transcriptional activation. This protein is processed by the enzyme Taspase 1 into two fragments, MLL-C and MLL-N. These fragments reassociate and further assemble into different multiprotein complexes that regulate the transcription of specific target genes, including many of the HOX genes. Multiple chromosomal translocations involving this gene are the cause of certain acute lymphoid leukemias and acute myeloid leukemias. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 11.5-14.5 with edematous bodies, petechiae, and hematopoietic insufficiency. Heterozygotes show reduced growth, hematopoietic abnormalities, and homeotic transformations of the axial skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 G A 11: 46,123,169 V329I probably damaging Het
Adgrl3 C A 5: 81,646,551 A541E possibly damaging Het
Agbl1 A T 7: 76,413,577 I263F probably damaging Het
Ash1l T C 3: 89,023,212 probably null Het
BC051142 G A 17: 34,448,796 C154Y possibly damaging Het
Bccip A G 7: 133,714,923 T91A probably benign Het
Bnc1 A T 7: 81,974,415 F355I probably damaging Het
Bpifa2 A T 2: 154,013,710 D185V probably damaging Het
Capn8 T A 1: 182,571,961 V89D probably damaging Het
Cfap46 A T 7: 139,661,190 M421K probably damaging Het
Chd2 A T 7: 73,480,508 L800M probably damaging Het
Chd4 A G 6: 125,100,986 D137G possibly damaging Het
Crtap A G 9: 114,390,140 Y154H probably benign Het
Ctdp1 T A 18: 80,456,088 Q213L probably damaging Het
Cts6 T C 13: 61,196,350 Y296C probably damaging Het
Daxx G T 17: 33,912,160 V354F probably benign Het
Dnah2 A G 11: 69,520,773 I341T possibly damaging Het
Epha2 A G 4: 141,309,069 D272G probably benign Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fbxl7 C A 15: 26,552,936 G82W probably damaging Het
Fcamr G A 1: 130,811,437 C158Y probably damaging Het
Fyb A C 15: 6,585,149 probably benign Het
Gars G A 6: 55,068,092 R454H probably damaging Het
Ghsr T C 3: 27,372,272 V159A probably benign Het
Glp1r A T 17: 30,918,887 Q97H probably benign Het
Gm27047 T C 6: 130,629,946 noncoding transcript Het
Igkv3-3 A C 6: 70,687,239 I22L probably benign Het
Inpp5b G T 4: 124,743,031 probably null Het
Ipo9 C A 1: 135,402,359 E448* probably null Het
Itgb2l A T 16: 96,427,803 I400N probably damaging Het
Kat6b T A 14: 21,516,994 H40Q probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnq2 G T 2: 181,086,761 probably benign Het
Klf7 T C 1: 64,079,280 T53A probably benign Het
Lrp10 C T 14: 54,468,345 R331C probably benign Het
Map4k5 A T 12: 69,831,558 D289E probably benign Het
Mfsd4b2 A T 10: 39,923,777 M43K possibly damaging Het
Msr1 T G 8: 39,623,956 R138S possibly damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Myh9 G A 15: 77,764,523 A1711V probably benign Het
Myo18b A G 5: 112,875,217 probably benign Het
Nampt A T 12: 32,833,121 N102Y possibly damaging Het
Nell2 T C 15: 95,473,579 I92V probably benign Het
Nes A G 3: 87,977,214 N883D probably benign Het
Neurl3 T A 1: 36,273,382 probably benign Het
Ocln T A 13: 100,539,422 T188S probably benign Het
Olfr1023 T C 2: 85,887,241 F147S probably benign Het
Olfr704 T A 7: 106,865,730 M250K probably damaging Het
Parp14 T A 16: 35,844,363 Q1305L probably benign Het
Pde3a C T 6: 141,487,956 Q855* probably null Het
Pde4b T C 4: 102,195,114 probably benign Het
Pdk2 T C 11: 95,039,416 M65V probably benign Het
Phf21a T C 2: 92,351,856 S377P probably damaging Het
Plcb2 T A 2: 118,718,222 T408S probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ppp6r2 A G 15: 89,282,949 D789G probably benign Het
Prdm16 T C 4: 154,335,262 M897V possibly damaging Het
Prss57 A G 10: 79,784,344 probably null Het
Psd G T 19: 46,322,468 L381I probably benign Het
Ptprq A T 10: 107,534,679 D2050E probably benign Het
Rfc1 G T 5: 65,266,162 N1034K probably damaging Het
Ryr3 C T 2: 112,831,159 G1829S probably benign Het
Scaper T C 9: 55,859,719 probably null Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Slc28a1 A G 7: 81,169,048 N583S possibly damaging Het
Slc35e3 C T 10: 117,744,979 G140D probably damaging Het
Slc6a9 G A 4: 117,868,150 probably null Het
Sptlc1 A G 13: 53,342,182 S376P probably benign Het
Sspo G A 6: 48,464,795 C1913Y probably damaging Het
Taar7b A T 10: 24,000,947 I337F possibly damaging Het
Tdpoz2 T A 3: 93,651,928 I246F probably damaging Het
Trpa1 C T 1: 14,875,959 V983M probably damaging Het
Trpm5 A T 7: 143,072,784 M1112K probably benign Het
Uso1 A T 5: 92,192,735 K670I probably benign Het
Washc4 A G 10: 83,556,907 D257G probably damaging Het
Wdr41 T A 13: 95,015,217 probably null Het
Zbtb17 A G 4: 141,466,549 Q668R possibly damaging Het
Other mutations in Kmt2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Kmt2a APN 9 44807934 unclassified probably benign
IGL00667:Kmt2a APN 9 44824386 utr 3 prime probably benign
IGL00828:Kmt2a APN 9 44820776 unclassified probably benign
IGL01080:Kmt2a APN 9 44809092 missense unknown
IGL01131:Kmt2a APN 9 44821170 unclassified probably benign
IGL01294:Kmt2a APN 9 44820297 unclassified probably benign
IGL01432:Kmt2a APN 9 44809096 missense unknown
IGL01646:Kmt2a APN 9 44825484 utr 3 prime probably benign
IGL01777:Kmt2a APN 9 44849005 missense probably damaging 0.99
IGL01944:Kmt2a APN 9 44849767 missense probably damaging 1.00
IGL02125:Kmt2a APN 9 44848686 missense probably damaging 1.00
IGL02207:Kmt2a APN 9 44847682 missense probably damaging 0.98
IGL02424:Kmt2a APN 9 44824635 utr 3 prime probably benign
IGL02499:Kmt2a APN 9 44830509 splice site probably benign
IGL02574:Kmt2a APN 9 44830513 splice site probably benign
IGL02711:Kmt2a APN 9 44824523 splice site probably benign
IGL02828:Kmt2a APN 9 44821947 unclassified probably benign
IGL03012:Kmt2a APN 9 44810966 unclassified probably benign
IGL03242:Kmt2a APN 9 44848392 missense probably damaging 0.99
IGL03294:Kmt2a APN 9 44820565 unclassified probably benign
IGL03326:Kmt2a APN 9 44818747 nonsense probably null
Chromas UTSW 9 44820342 unclassified probably benign
Heteros UTSW 9 44828811 nonsense probably null
Pyknos UTSW 9 44826828 utr 3 prime probably benign
Skies UTSW 9 44829261 utr 3 prime probably benign
spacious UTSW 9 44847645 missense probably benign 0.03
PIT4402001:Kmt2a UTSW 9 44841062 missense unknown
R0076:Kmt2a UTSW 9 44830059 utr 3 prime probably benign
R0076:Kmt2a UTSW 9 44830059 utr 3 prime probably benign
R0180:Kmt2a UTSW 9 44826851 utr 3 prime probably benign
R0363:Kmt2a UTSW 9 44809713 critical splice donor site probably null
R0411:Kmt2a UTSW 9 44819964 unclassified probably benign
R0555:Kmt2a UTSW 9 44847571 missense probably damaging 1.00
R0587:Kmt2a UTSW 9 44847534 missense probably damaging 0.99
R0865:Kmt2a UTSW 9 44818770 unclassified probably benign
R0988:Kmt2a UTSW 9 44848549 missense probably benign 0.03
R1006:Kmt2a UTSW 9 44847696 missense probably damaging 0.99
R1108:Kmt2a UTSW 9 44849062 missense probably damaging 1.00
R1292:Kmt2a UTSW 9 44814694 utr 3 prime probably benign
R1322:Kmt2a UTSW 9 44821121 unclassified probably benign
R1476:Kmt2a UTSW 9 44824635 utr 3 prime probably benign
R1485:Kmt2a UTSW 9 44826928 utr 3 prime probably benign
R1487:Kmt2a UTSW 9 44833990 utr 3 prime probably benign
R1493:Kmt2a UTSW 9 44846905 missense probably damaging 1.00
R1499:Kmt2a UTSW 9 44848266 missense probably benign 0.36
R1507:Kmt2a UTSW 9 44818403 unclassified probably benign
R1603:Kmt2a UTSW 9 44841561 unclassified probably null
R1635:Kmt2a UTSW 9 44824369 utr 3 prime probably benign
R1662:Kmt2a UTSW 9 44836670 utr 3 prime probably benign
R1711:Kmt2a UTSW 9 44841621 missense unknown
R1785:Kmt2a UTSW 9 44819675 unclassified probably benign
R1786:Kmt2a UTSW 9 44819675 unclassified probably benign
R1919:Kmt2a UTSW 9 44820345 unclassified probably benign
R1964:Kmt2a UTSW 9 44820644 missense probably benign 0.23
R1965:Kmt2a UTSW 9 44821460 unclassified probably benign
R2029:Kmt2a UTSW 9 44818450 missense probably benign 0.23
R2054:Kmt2a UTSW 9 44823374 utr 3 prime probably benign
R2259:Kmt2a UTSW 9 44881142 unclassified probably benign
R2382:Kmt2a UTSW 9 44820910 unclassified probably benign
R2483:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R3033:Kmt2a UTSW 9 44821863 unclassified probably benign
R3423:Kmt2a UTSW 9 44820097 unclassified probably benign
R3428:Kmt2a UTSW 9 44848119 missense probably benign 0.06
R3605:Kmt2a UTSW 9 44849196 missense probably damaging 1.00
R3607:Kmt2a UTSW 9 44849196 missense probably damaging 1.00
R3611:Kmt2a UTSW 9 44822466 unclassified probably benign
R3623:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R3745:Kmt2a UTSW 9 44831340 utr 3 prime probably benign
R3806:Kmt2a UTSW 9 44820356 unclassified probably benign
R3841:Kmt2a UTSW 9 44831291 utr 3 prime probably benign
R3855:Kmt2a UTSW 9 44830499 utr 3 prime probably benign
R4027:Kmt2a UTSW 9 44836693 utr 3 prime probably benign
R4124:Kmt2a UTSW 9 44819796 unclassified probably benign
R4177:Kmt2a UTSW 9 44820983 unclassified probably benign
R4296:Kmt2a UTSW 9 44821175 unclassified probably benign
R4414:Kmt2a UTSW 9 44809780 unclassified probably benign
R4461:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R4668:Kmt2a UTSW 9 44824572 utr 3 prime probably benign
R4761:Kmt2a UTSW 9 44849124 missense probably damaging 1.00
R4812:Kmt2a UTSW 9 44831354 utr 3 prime probably benign
R4815:Kmt2a UTSW 9 44821256 unclassified probably benign
R4817:Kmt2a UTSW 9 44821466 unclassified probably benign
R4888:Kmt2a UTSW 9 44821680 unclassified probably benign
R4958:Kmt2a UTSW 9 44848467 missense probably damaging 1.00
R5065:Kmt2a UTSW 9 44842700 unclassified probably benign
R5185:Kmt2a UTSW 9 44820246 unclassified probably benign
R5358:Kmt2a UTSW 9 44819274 unclassified probably benign
R5411:Kmt2a UTSW 9 44848485 missense probably damaging 1.00
R5420:Kmt2a UTSW 9 44848336 missense probably damaging 1.00
R5483:Kmt2a UTSW 9 44824624 utr 3 prime probably benign
R5487:Kmt2a UTSW 9 44821975 unclassified probably benign
R5488:Kmt2a UTSW 9 44841038 utr 3 prime probably benign
R5489:Kmt2a UTSW 9 44841038 utr 3 prime probably benign
R5538:Kmt2a UTSW 9 44820342 unclassified probably benign
R5576:Kmt2a UTSW 9 44842634 missense possibly damaging 0.94
R5631:Kmt2a UTSW 9 44820688 unclassified probably benign
R5781:Kmt2a UTSW 9 44847842 nonsense probably null
R5789:Kmt2a UTSW 9 44819904 unclassified probably benign
R5932:Kmt2a UTSW 9 44820647 unclassified probably benign
R6027:Kmt2a UTSW 9 44819290 unclassified probably benign
R6191:Kmt2a UTSW 9 44826828 utr 3 prime probably benign
R6239:Kmt2a UTSW 9 44819796 unclassified probably benign
R6291:Kmt2a UTSW 9 44832874 utr 3 prime probably benign
R6344:Kmt2a UTSW 9 44821859 unclassified probably benign
R6611:Kmt2a UTSW 9 44849272 missense probably damaging 0.98
R6641:Kmt2a UTSW 9 44819835 unclassified probably benign
R6651:Kmt2a UTSW 9 44828811 nonsense probably null
R6825:Kmt2a UTSW 9 44818407 unclassified probably benign
R6853:Kmt2a UTSW 9 44818407 unclassified probably benign
R6897:Kmt2a UTSW 9 44847645 missense probably benign 0.03
R6930:Kmt2a UTSW 9 44842665 unclassified probably benign
R6932:Kmt2a UTSW 9 44829261 utr 3 prime probably benign
R6957:Kmt2a UTSW 9 44820022 unclassified probably benign
R7170:Kmt2a UTSW 9 44810721 missense unknown
R7202:Kmt2a UTSW 9 44847715 missense probably benign 0.03
R7481:Kmt2a UTSW 9 44809071 missense unknown
R7538:Kmt2a UTSW 9 44847744 missense probably damaging 0.99
R7597:Kmt2a UTSW 9 44831353 missense unknown
R7741:Kmt2a UTSW 9 44808062 missense unknown
R7767:Kmt2a UTSW 9 44818998 missense unknown
R7768:Kmt2a UTSW 9 44820603 missense unknown
X0021:Kmt2a UTSW 9 44831235 utr 3 prime probably benign
X0025:Kmt2a UTSW 9 44825392 nonsense probably null
X0026:Kmt2a UTSW 9 44820906 unclassified probably benign
X0027:Kmt2a UTSW 9 44880896 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CACGACCGAAAGCCTAAGTG -3'
(R):5'- CAGAAGCTCCTAACGGTGTG -3'

Sequencing Primer
(F):5'- GCCTAAGTGACAAGAATTCTCG -3'
(R):5'- CTCCTAACGGTGTGAGGCTG -3'
Posted On2016-06-06